Effect of apolipoprotein E gene polymorphisms on pathogenesis of coronary atherosclerosis disease
http://www.100md.com
《中华医药杂志》英文版
【Abstract】 Objective Apolipoprotein E(apoE) is a constituent of lipoproteins with considerable variation due to cysteine ?rginine exchanges. We investigated the relationship between apo E gene polymorphism and the occurrence of CAD in northern Chineses. Methods The distributions of the HhaI polymorphisms of the apolipoprotein E gene and blood lipids levels were determined among 132 Chinese subjects in relation to circulating lipids and coronary angiography. Results The demographic information for 132 subjects showed that subjects with CAD tended to have more unfavorable lipoprotein variables. Genotype distributions at both sites were different between the CAD and control groups. The apolipoprotein E gene alleles were associated with the plasma levels of lipids and lipoproteins (all P<0.05); The control group had higher apo E“ε2”frequencies than the CAD group (P<0.001) and “ε2” was significantly correlated with low occurrence of CAD (P<0.001). Conclusion The results suggest that the apolipoprotein E gene polymorphism do have influence circulating levels of lipids and lipoproteins and that individuals with apo E“ε2”are likely to have a reduced risk of developing CAD in northern Chineses.
【Key words】 apolipoprotein E;DNA ?olymorphism;lipoprotein; coronary atherosclerosis disease
Coronary atherosclerosis disease (CAD) is the major cause of death and disability in developed and developing countries. The major CAD risk factors include advancing age, male sex, hypertension, smoking, diabetes, elevated total serum cholesterol and low ?ensity lipoprotein (LDL) cholesterol and decreased high ?ensity lipoprotein (HDL) cholesterol, and family history of premature CAD[1]. Identification of genetic factors may help us to study the mechanisms of CAD. Variation in one candidate genetic factor, the apolipoprotein (apo) E gene, is known as apo E polymorphism. We know that apo E is a serum glycoprotein existing in circulating chylomicrons, chylomicron remants, very low ?ensity lipoprotein, and a subgroup of HDLs. It serves as a ligand of the receptor ?ediated uptake of cholesterol ?ich articles by hepatocytes and peripheral tissues. The common allele of the apo E gene is the ε3 ?llele, which encodes for cysteine at amino acid residue 112 and for arginine at residue 158. The ε4 ?llele encodes for arginine at both residues and ε2 ?llele for cysteine at both residues. Some studies have reported that the apo E polymorphism is associated with CAD[2-5]. Our purpose was to assess the relationship between apo E genotype and CAD population.
METHODS
All subjects are Chinese adults and have no blood relationship: ① CAD group: 89 patients (68 males and 21 females) verified by coronary artery angiography (CAG), averaging 54 years old; CAG showed that there were ≥ 50% luminal obstruction in at least one branch of the coronary vessel lesion. ②Control group: 43 healthy subjects (33 males and 10 females) verified by CAG, averaging 51 years old.
A 10ml venous blood sample was drawn into an EDTA sample tube from all subjects before CAG after at least a 6h fast. The blood sample was centrifuged within 2h and plasma and cellular components stored separately at 70°C in aliquot until analysis.
Determination of polymorphisms in the apo E gene leucocyte DNA was extracted from these frozen cellular samples through salting[6]. Apo E genotype was performed as described by Hixson and Vernier[7]. The following primers were used to amplify a 244bp segment 5 皙nd of the apo E gene.
P1：5’ 皙CAGAATTCGCCCCGGCCTGGTACAC ’
P2：5 皙TTAGCTTGGCACGGCTGTCCAAGGA
There are two HhaI restriction sites within the region amplified by the PCR and these are located at 112bp, 158bp. The controlling marker is pGEM zf(+), six pieces were found, they were 91bp, 83bp, 72bp, 48bp, 36bp, and 35bp. Meanwhile, six genotypes were determined, they were E2/2,E2/3,E2/4,E3/3,E3/4,E4/4, carried by ε2,ε3,ε4.
Biochemical analysis
Total cholesterol, HDL cholesterol and triglyceride levels were measured by the hospital ? clinical chemistry department using standard enzymatic methods. The LDL cholesterol levels were calculated using the Friedewald formula. Levels of apo A1, apo B,and Lp(a) were measured using immuno ?urbidimetric methods[8,9]. Coefficients of variation between runs for all lipid assays were less than 5%.
Statistical analysis
We determined whether or not the distributions of genotypes were in Hardy einberg equilibrium through χ2 analysis. The frequencies of the alleles and genotypes among different subgroups were compared using χ2-test. Biochemical quantities data were analyzed by t ?est. Population attributable risk was calculated using the odds ratioes from the Logistic regression models and the prevalence of apo E genotypes.
RESULTS
1. The baseline characteristics in CAD group and control group were summarized in Table 1.
2. Apo E gene 112bp and 158bp sites polymorphisms genotype frequency distribution characteristics in CAD group and control group were shown in Table 2.
3.Analysis on lipid levels related to apo E genotypes in two group were summarized in able 3.
4.Logistic analysis on risk factors of the studying population were demonstrated in Table 4.
The demographic information for 132 subjects showed that the subjects with CAD tended to have more unfavorable lipoprotein variables. Genotype distributions at 112bp and 158bp sites were different between the CAD and control groups. We also performed a Logistic regression analysis on blood lipids, apo E gene site genotype frequencies and occurrence of CAD. The results suggested the ε2 llele was associated with the favorable levels of lipids and lipoprotein, as well as decreased occurrence of CAD. The Logistic analysis of maximum likelihood estimates suggested that the ε2 llele frequencies were significantly correlated with occurrence of CAD (RR=4.1695, 95%CI 1.28 .86,P<0.001).
DISCUSSION
Previous studies have shown that elevated LDL cholesterol levels are associated with increased occurrence and severity of coronary artery disease[10-14]. Multiple risk factors for CAD have been identified in previous studies. Recently, pathogenesis studies of CAD included a continued search for risk factors for CAD microscopically and identication of susceptible genetic mechanisms in pathogenesis[15,16]. A number of studies have shown that coronary artery disease severity is associated with the epsilon 2/ epsilon 3/ epsilon 4 polymorphism in the coding region of the apo E gene. Apo E has important functions in systemic and local lipid transport. Apo E is a protein constituent of both triglyceride ?ich lipoproteins (TRL) as well as HDL, which plays an important role in liver uptake of TRL remnants. Apo E has three common alleles known as ε2,ε3 and ε4. The receptor ?inding function of apo E is allele ?pecific. The various apo E isoforms differ in binding affinity for the LDL ?eceptor and the LDL ?eceptor related protein, for HDL cholesterol, and for triglyceride ?ich lipoprotein particles. Apo E 2 and 3 preferentially bind to the smaller of the known HDL fractions, while apo E 4 more often bind to the larger, triglyceride ?ich LDL fractions. The relationship between apo E and coronary atherosclerosis disease has been the subject of a considerable amount of research. However, this relationship is far from clearly defined. The results were controversial each other[17-24].
The present study investigated blood lipids levels in 132 subjects (89 patients with CAD and 43 healthy persons) and analyzed the apo E gene 112bp and 158bp sites polymorphisms features. The demographic information for 132 subjects showed that the subjects with CAD tended to have more unfavorable lipoprotein variables. Genotype distributions at both sites differed from the CAD group and control group. In addition, the control group demonstrated higher apo E 2 frequencies than the CAD group (P<0.05). The results were basically consistent with previously studies[17-19]. The variation at the apo E gene locus may affect levels of total cholesterol and LDL cholesterol in the general population. The presence of the ε2 allele may result in decreased LDL cholesterol because of delayed clearance of chylomicron remnants by the liver and upregulation of LDL receptor activity. These associations affecting well ?nown lipid ?elated CAD risk factors suggest that variation at this locus could be a major determinant of CAD risk in the general population. Variability in the reported associations between apo E genotype and CAD risk may due to different environmental exposures affecting the association between apo E alleles and plasma lipid levels[25-27]. Several diseases and their treatment may also influence this relationship. Recent study showed that the therapeutic effects of HMG ?oA reductase inhibitors (statins) may depend on the presence of a functional apo E[28-30]. The variability in drug response originates partly from genetics, with possible consequences for drug efficacy, adverse effects, and toxicity. Until now, pharmacogenetics mainly indicated the best known source of variability, that is, the variability caused by drug metabolism. From the risk concept emphasizing impaired metabolism and adverse effects, we now moved to an approach, which is a personalized, genotype ?ependent adaptation of therapy. Similar gene ?nvironment interactions have been reported in several other populations[31-33].
In summary, these data provide evidence suggesting that apo E gene is a prototypical susceptibility gene and they also suggest that apo E gene polymorphisms play an important role in the pathophysiology of atherosclerosis and occurrence of coronary atherosclerosis disease, with an decreased burden of disease being observed in CAD patients with the ε2 allele, compared to subjects with ε3 and ε4 alleles and that the ε2 allele has a potential protective effect on developing CAD. More research is required to define the place of apo E genotype in the management of coronary atherosclerosis disease in its various forms[34-36]. Whatever the future brings, the evaluation of apo E genotypes will need to be rapid, cheap, and technically undemanding before this investigation becomes widely available and clinically relevant. Apo E polymorphism is associated with varying risk of cardiovascular disease, but other interesting aspects may emerge in the future.
REFERENCES
1. Cleeman JI. Executive summary of the third report of the national cholesterol education program (NCEP) expert panel on detection, evalution, and treatment of high blood cholesterol in adults (adult treatment panel III). JAMA,2001,285:2486-2497.
2. Ozturk IC, Killeen AA. An overview of genetic factors influencing plasma lipid levels and coronary artery disease risk. Arch Pathol Lab Med,1999,123:1219-1222.
3. ZOU Yangchun, HE Bingxia, HU Dayi, YANG Xinchun, JIA Xingyuan, WANG Lefeng, et al. Studies on relationships among apolipoproteinA1 gene polymorphisms, lipid levels and coronary atherosclerosis disease. Chinese Medical Journal. 2003,116(5):665-668.
4. Lahoz C, Schaefer EJ, Cupples LA,et al. Apolipoprotein E genotype and cardiovascular disease in the Framingham Heart Study. Atherosclerosis,2001,154:529-537.
5. Kobayashi J, Saito Y, Tiara K,et al. Effect of apolipoprotein E3/4 phenotype on postprandial triglycerides and retinyl palmitate metabolism in plasma from hyperlipidemic subjects in Japan. Atherosclerosis, 2001,154:539-546.
6. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res,1989,16:12-15.
7. Hixson JE, Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res,1990,31:545-548.
8. Yangchun Z, HE Bingxian, Dayi H, et al. Nationality differences in distributions of serum lipids, lipoproteins and apolipoprotein levels in Xinjiang China. Chinese Medical Journal.2001,114(11): 1128-1131.
9. Borque1. Automated turbidimetry of serum Lp(a). Eur J Clin Chen Clin Biohem,1994,12:16-22.
10. Smith GD, Shipley MJ, Marmot MG, et al. Plasma cholesterol concentration and mortality.J Am Med Assoc,1992,267:70-76.
11. McGill HC. Major risk factors and primary prevention. In:Fuster V, Ross R, Topol E. Atherosclerosis and Coronary Heart Disease. Philadephia:Lippincott aven,1996,25-41.
12. Group SSSS. Randomized trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study(4S). Lancet,1994,344:1383-1389.
13. Gayton J, Klemp K. Development of the lipid ?ich core in human atherosclerosis. Atheroscler Thromb Vasc Biol,1996,16:4-11.
14. The Long ?erm Intervention with Pravastatin in Ischaemic Disease (LIPID) Study Group. Prevention of cardiovascular events and a broad range of initial cholesterol levels. N Engl J Med,1998,339:1349-57.
15. Whittes CJM, Brunner EJ, Shipley MJ,et al. Differences in biological risk factors for cardiovascular disease between three ethnic groups in the Whitehall II study. Atherosclerosis,1999,142:279-286.
16. Fabris C, Toniutto P, Bitetto D,et al. Low fibrosis progression of recurrent hepatitis C in apolipoprotein E epsilon 4 carriers: relationship with the blood lipid profile. Liver Int. 2005,25(6):1128-35.
17. Corbo RM, Vilardo T, Ruggeri M,et al. Apolipoprotein E genotype and plasma levels in coronary artery disease. A case ontrol study in the Italian population. Clin Biochem,1999,32:217-222.
18. Ye S, Dunleavey L, Bannister W,et al. Independent effects of the-219 G>T and epsilon 2/ epsilon 3/ epsilon 4 polymorphisms in the apolipoprotein E gene on coronary artery disease: the Southampton Atherosclerosis Study. Eur J Hum Genet,2003,11(6):437-443.
19. Moore JH, Reilly SL, Ferrell RE, et al. The role of the apolipoprotein E polymorphism in the prediction of coronary artery disease age of onset. Clin Genet,1999,51:22-25.
20. Kolovou G, Daskalova D, Mikhailidis DP. Apolipoprotein E polymorphism and atherosclerosis. Angiology,2003,54(1):59-71.
21. Gerdes LU. The common polymorphism of apolipoprotein E: geographical aspects and new pathophysiological relations. Clin Chem Lab Med,2003,41(5):628-631.
22. Guerra A, Rego C, Castro EM,et al. Influence of apolipoprotein e polymorphism on cardiovascular risk factors in obese children. Ann Nutr Metab,2003,47(2):49-54.
23. Kolovou GD, Daskalova DC, Hatzivassiliou M, et al.The epsilon 2 and 4 alleles of apolipoprotein E and ischemic vascular events in the Greek population ?mplications for the interpretation of similar studies. Angiology,2003,54(1):51-58.
24. Langheinrich AC, Michniewicz A, Sedding DG, et al. Correlation of vasa vasorum neovascularization and plaque progression in aortas of apolipoprotein E(-/-)/low-density lipoprotein(-/-) double knockout mice. Arterioscler Thromb Vasc Biol,2006,26(2):347-52.
25. Kuhlencordt PJ, Chen J, Han F, et al. Genetic deficiency of inducible niteic oxide synthase reduces atherosclerosis and lowers plasma lipid peroxides in apolipoprotein E nockout mice. Circulation,2001,103:3099-3104.
26. Detmer PA, Hernandez M, Mudgett J, et al. Deficiency in inducible nitric oxide synthase results in reduced atherosclerosis in apolipoprotein E ?eficient mice. J Immunol,2000,165:3430-3435.
27. Knowles JW, Reddick RL, Jennette JC, et al. Enhanced atherosclerosis and kidney dysfunction in eNOS (-/-) mice are ameliorated by enalapril treatment. J Clin Invest,2000,105:451-458.
28. Wang YX, Martin ?cNulty B, Huw LY, et al. Anti therosclerotic effect of simvastatin depends on presence of apolipoprotein E. Atherosclerosis,2002,162:23-31.
29. Van de Poll S, Delsing DJM, Jukema JW, et al. Raman spectroscopic investigation of atorvastatin, amlodipine, and both on atherosclerotic plaque development in APOE*3 Leiden transgenic mice. Atherosclerosis, 2002,164:65-71.
30. Siest G, Ferrari L, Accaoui MJ, et al. Pharmacogenomics of drugs affecting the cardiovascular system. Clin Chem Lab Med,2003,41(4):590-599.
31. Ye S, Huang Y, Mullendorff K, et al. Apolipoprotein (apo) E4 enhances amyloid beta peptide production in cultured neuronal cells: apoE structure as a potential therapeutic target. Proc Natl Acad Sci U S A,2005,102(51):18700-5.
32. Llaverias G, Rebollo A, Pou J, et al. Effects of rosiglitazone and atorvastatin on the expression of genes that control cholesterol homeostasis in differentiating monocytes. Biochem Pharmacol,2006,71(5):605-14.
33. Kajinami K, Akao H, Polisecki E, Schaefer EJ. Pharmacogenomics of statin responsiveness. Am J Cardiol,2005,96(9A):65K-70K.
34. Pang RW, Tam S, Janus ED, et al. Plasma lipid, lipoprotein and apolipoprotein levels in a random population sample of 2875 Hong Kong Chinese adults and their implications (NCEP ATP-III, 2001 guidelines) on cardiovascular risk assessment. Atherosclerosis,2006,184(2):438-45.
35. Fan PL,Chen CD, Kao WT, et al. Protective effect of the apo epsilon 2 allele in major depressive disorder in Taiwanese. Acta Psychiatr Scand,2006,113(1):48-53.
36. Chyu KY, Zhao X, Reyes OS, et al. Immunization using an Apo B-100 related epitope reduces atherosclerosis and plaque inflammation in hypercholesterolemic apo E (-/-) mice. Biochem Biophys Res Commun,2005,338(4),1982-9.
1. The Heart Center and the Basic Medical Center, Affiliated Beijing Chaoyang Hospital, Capital University of Medical Science, Beijing 100020, China
2. Department of Cardiology, First Affiliated Hospital, Xinjiang Medical University, Urumqi,Xinjiang 830054
3. The Department of Cardiology, Affiliated Renmin Hospital, Peking University, Beijing 100044, China
*Correspondence to Dr. Zou Yangchun, the Heart Center, Affiliated Beijing Chaoyang Hospital, Capital University of Medical Science, Beijing 100020, China,Tel/Fax:86 10 65951064,
email:yangchunzou@hotmail.com.cn
(Editor Guo Hui-ling)(ZOU Yang hun1, HONG Xiu a)
【Key words】 apolipoprotein E;DNA ?olymorphism;lipoprotein; coronary atherosclerosis disease
Coronary atherosclerosis disease (CAD) is the major cause of death and disability in developed and developing countries. The major CAD risk factors include advancing age, male sex, hypertension, smoking, diabetes, elevated total serum cholesterol and low ?ensity lipoprotein (LDL) cholesterol and decreased high ?ensity lipoprotein (HDL) cholesterol, and family history of premature CAD[1]. Identification of genetic factors may help us to study the mechanisms of CAD. Variation in one candidate genetic factor, the apolipoprotein (apo) E gene, is known as apo E polymorphism. We know that apo E is a serum glycoprotein existing in circulating chylomicrons, chylomicron remants, very low ?ensity lipoprotein, and a subgroup of HDLs. It serves as a ligand of the receptor ?ediated uptake of cholesterol ?ich articles by hepatocytes and peripheral tissues. The common allele of the apo E gene is the ε3 ?llele, which encodes for cysteine at amino acid residue 112 and for arginine at residue 158. The ε4 ?llele encodes for arginine at both residues and ε2 ?llele for cysteine at both residues. Some studies have reported that the apo E polymorphism is associated with CAD[2-5]. Our purpose was to assess the relationship between apo E genotype and CAD population.
METHODS
All subjects are Chinese adults and have no blood relationship: ① CAD group: 89 patients (68 males and 21 females) verified by coronary artery angiography (CAG), averaging 54 years old; CAG showed that there were ≥ 50% luminal obstruction in at least one branch of the coronary vessel lesion. ②Control group: 43 healthy subjects (33 males and 10 females) verified by CAG, averaging 51 years old.
A 10ml venous blood sample was drawn into an EDTA sample tube from all subjects before CAG after at least a 6h fast. The blood sample was centrifuged within 2h and plasma and cellular components stored separately at 70°C in aliquot until analysis.
Determination of polymorphisms in the apo E gene leucocyte DNA was extracted from these frozen cellular samples through salting[6]. Apo E genotype was performed as described by Hixson and Vernier[7]. The following primers were used to amplify a 244bp segment 5 皙nd of the apo E gene.
P1：5’ 皙CAGAATTCGCCCCGGCCTGGTACAC ’
P2：5 皙TTAGCTTGGCACGGCTGTCCAAGGA
There are two HhaI restriction sites within the region amplified by the PCR and these are located at 112bp, 158bp. The controlling marker is pGEM zf(+), six pieces were found, they were 91bp, 83bp, 72bp, 48bp, 36bp, and 35bp. Meanwhile, six genotypes were determined, they were E2/2,E2/3,E2/4,E3/3,E3/4,E4/4, carried by ε2,ε3,ε4.
Biochemical analysis
Total cholesterol, HDL cholesterol and triglyceride levels were measured by the hospital ? clinical chemistry department using standard enzymatic methods. The LDL cholesterol levels were calculated using the Friedewald formula. Levels of apo A1, apo B,and Lp(a) were measured using immuno ?urbidimetric methods[8,9]. Coefficients of variation between runs for all lipid assays were less than 5%.
Statistical analysis
We determined whether or not the distributions of genotypes were in Hardy einberg equilibrium through χ2 analysis. The frequencies of the alleles and genotypes among different subgroups were compared using χ2-test. Biochemical quantities data were analyzed by t ?est. Population attributable risk was calculated using the odds ratioes from the Logistic regression models and the prevalence of apo E genotypes.
RESULTS
1. The baseline characteristics in CAD group and control group were summarized in Table 1.
2. Apo E gene 112bp and 158bp sites polymorphisms genotype frequency distribution characteristics in CAD group and control group were shown in Table 2.
3.Analysis on lipid levels related to apo E genotypes in two group were summarized in able 3.
4.Logistic analysis on risk factors of the studying population were demonstrated in Table 4.
The demographic information for 132 subjects showed that the subjects with CAD tended to have more unfavorable lipoprotein variables. Genotype distributions at 112bp and 158bp sites were different between the CAD and control groups. We also performed a Logistic regression analysis on blood lipids, apo E gene site genotype frequencies and occurrence of CAD. The results suggested the ε2 llele was associated with the favorable levels of lipids and lipoprotein, as well as decreased occurrence of CAD. The Logistic analysis of maximum likelihood estimates suggested that the ε2 llele frequencies were significantly correlated with occurrence of CAD (RR=4.1695, 95%CI 1.28 .86,P<0.001).
DISCUSSION
Previous studies have shown that elevated LDL cholesterol levels are associated with increased occurrence and severity of coronary artery disease[10-14]. Multiple risk factors for CAD have been identified in previous studies. Recently, pathogenesis studies of CAD included a continued search for risk factors for CAD microscopically and identication of susceptible genetic mechanisms in pathogenesis[15,16]. A number of studies have shown that coronary artery disease severity is associated with the epsilon 2/ epsilon 3/ epsilon 4 polymorphism in the coding region of the apo E gene. Apo E has important functions in systemic and local lipid transport. Apo E is a protein constituent of both triglyceride ?ich lipoproteins (TRL) as well as HDL, which plays an important role in liver uptake of TRL remnants. Apo E has three common alleles known as ε2,ε3 and ε4. The receptor ?inding function of apo E is allele ?pecific. The various apo E isoforms differ in binding affinity for the LDL ?eceptor and the LDL ?eceptor related protein, for HDL cholesterol, and for triglyceride ?ich lipoprotein particles. Apo E 2 and 3 preferentially bind to the smaller of the known HDL fractions, while apo E 4 more often bind to the larger, triglyceride ?ich LDL fractions. The relationship between apo E and coronary atherosclerosis disease has been the subject of a considerable amount of research. However, this relationship is far from clearly defined. The results were controversial each other[17-24].
The present study investigated blood lipids levels in 132 subjects (89 patients with CAD and 43 healthy persons) and analyzed the apo E gene 112bp and 158bp sites polymorphisms features. The demographic information for 132 subjects showed that the subjects with CAD tended to have more unfavorable lipoprotein variables. Genotype distributions at both sites differed from the CAD group and control group. In addition, the control group demonstrated higher apo E 2 frequencies than the CAD group (P<0.05). The results were basically consistent with previously studies[17-19]. The variation at the apo E gene locus may affect levels of total cholesterol and LDL cholesterol in the general population. The presence of the ε2 allele may result in decreased LDL cholesterol because of delayed clearance of chylomicron remnants by the liver and upregulation of LDL receptor activity. These associations affecting well ?nown lipid ?elated CAD risk factors suggest that variation at this locus could be a major determinant of CAD risk in the general population. Variability in the reported associations between apo E genotype and CAD risk may due to different environmental exposures affecting the association between apo E alleles and plasma lipid levels[25-27]. Several diseases and their treatment may also influence this relationship. Recent study showed that the therapeutic effects of HMG ?oA reductase inhibitors (statins) may depend on the presence of a functional apo E[28-30]. The variability in drug response originates partly from genetics, with possible consequences for drug efficacy, adverse effects, and toxicity. Until now, pharmacogenetics mainly indicated the best known source of variability, that is, the variability caused by drug metabolism. From the risk concept emphasizing impaired metabolism and adverse effects, we now moved to an approach, which is a personalized, genotype ?ependent adaptation of therapy. Similar gene ?nvironment interactions have been reported in several other populations[31-33].
In summary, these data provide evidence suggesting that apo E gene is a prototypical susceptibility gene and they also suggest that apo E gene polymorphisms play an important role in the pathophysiology of atherosclerosis and occurrence of coronary atherosclerosis disease, with an decreased burden of disease being observed in CAD patients with the ε2 allele, compared to subjects with ε3 and ε4 alleles and that the ε2 allele has a potential protective effect on developing CAD. More research is required to define the place of apo E genotype in the management of coronary atherosclerosis disease in its various forms[34-36]. Whatever the future brings, the evaluation of apo E genotypes will need to be rapid, cheap, and technically undemanding before this investigation becomes widely available and clinically relevant. Apo E polymorphism is associated with varying risk of cardiovascular disease, but other interesting aspects may emerge in the future.
REFERENCES
1. Cleeman JI. Executive summary of the third report of the national cholesterol education program (NCEP) expert panel on detection, evalution, and treatment of high blood cholesterol in adults (adult treatment panel III). JAMA,2001,285:2486-2497.
2. Ozturk IC, Killeen AA. An overview of genetic factors influencing plasma lipid levels and coronary artery disease risk. Arch Pathol Lab Med,1999,123:1219-1222.
3. ZOU Yangchun, HE Bingxia, HU Dayi, YANG Xinchun, JIA Xingyuan, WANG Lefeng, et al. Studies on relationships among apolipoproteinA1 gene polymorphisms, lipid levels and coronary atherosclerosis disease. Chinese Medical Journal. 2003,116(5):665-668.
4. Lahoz C, Schaefer EJ, Cupples LA,et al. Apolipoprotein E genotype and cardiovascular disease in the Framingham Heart Study. Atherosclerosis,2001,154:529-537.
5. Kobayashi J, Saito Y, Tiara K,et al. Effect of apolipoprotein E3/4 phenotype on postprandial triglycerides and retinyl palmitate metabolism in plasma from hyperlipidemic subjects in Japan. Atherosclerosis, 2001,154:539-546.
6. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res,1989,16:12-15.
7. Hixson JE, Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res,1990,31:545-548.
8. Yangchun Z, HE Bingxian, Dayi H, et al. Nationality differences in distributions of serum lipids, lipoproteins and apolipoprotein levels in Xinjiang China. Chinese Medical Journal.2001,114(11): 1128-1131.
9. Borque1. Automated turbidimetry of serum Lp(a). Eur J Clin Chen Clin Biohem,1994,12:16-22.
10. Smith GD, Shipley MJ, Marmot MG, et al. Plasma cholesterol concentration and mortality.J Am Med Assoc,1992,267:70-76.
11. McGill HC. Major risk factors and primary prevention. In:Fuster V, Ross R, Topol E. Atherosclerosis and Coronary Heart Disease. Philadephia:Lippincott aven,1996,25-41.
12. Group SSSS. Randomized trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study(4S). Lancet,1994,344:1383-1389.
13. Gayton J, Klemp K. Development of the lipid ?ich core in human atherosclerosis. Atheroscler Thromb Vasc Biol,1996,16:4-11.
14. The Long ?erm Intervention with Pravastatin in Ischaemic Disease (LIPID) Study Group. Prevention of cardiovascular events and a broad range of initial cholesterol levels. N Engl J Med,1998,339:1349-57.
15. Whittes CJM, Brunner EJ, Shipley MJ,et al. Differences in biological risk factors for cardiovascular disease between three ethnic groups in the Whitehall II study. Atherosclerosis,1999,142:279-286.
16. Fabris C, Toniutto P, Bitetto D,et al. Low fibrosis progression of recurrent hepatitis C in apolipoprotein E epsilon 4 carriers: relationship with the blood lipid profile. Liver Int. 2005,25(6):1128-35.
17. Corbo RM, Vilardo T, Ruggeri M,et al. Apolipoprotein E genotype and plasma levels in coronary artery disease. A case ontrol study in the Italian population. Clin Biochem,1999,32:217-222.
18. Ye S, Dunleavey L, Bannister W,et al. Independent effects of the-219 G>T and epsilon 2/ epsilon 3/ epsilon 4 polymorphisms in the apolipoprotein E gene on coronary artery disease: the Southampton Atherosclerosis Study. Eur J Hum Genet,2003,11(6):437-443.
19. Moore JH, Reilly SL, Ferrell RE, et al. The role of the apolipoprotein E polymorphism in the prediction of coronary artery disease age of onset. Clin Genet,1999,51:22-25.
20. Kolovou G, Daskalova D, Mikhailidis DP. Apolipoprotein E polymorphism and atherosclerosis. Angiology,2003,54(1):59-71.
21. Gerdes LU. The common polymorphism of apolipoprotein E: geographical aspects and new pathophysiological relations. Clin Chem Lab Med,2003,41(5):628-631.
22. Guerra A, Rego C, Castro EM,et al. Influence of apolipoprotein e polymorphism on cardiovascular risk factors in obese children. Ann Nutr Metab,2003,47(2):49-54.
23. Kolovou GD, Daskalova DC, Hatzivassiliou M, et al.The epsilon 2 and 4 alleles of apolipoprotein E and ischemic vascular events in the Greek population ?mplications for the interpretation of similar studies. Angiology,2003,54(1):51-58.
24. Langheinrich AC, Michniewicz A, Sedding DG, et al. Correlation of vasa vasorum neovascularization and plaque progression in aortas of apolipoprotein E(-/-)/low-density lipoprotein(-/-) double knockout mice. Arterioscler Thromb Vasc Biol,2006,26(2):347-52.
25. Kuhlencordt PJ, Chen J, Han F, et al. Genetic deficiency of inducible niteic oxide synthase reduces atherosclerosis and lowers plasma lipid peroxides in apolipoprotein E nockout mice. Circulation,2001,103:3099-3104.
26. Detmer PA, Hernandez M, Mudgett J, et al. Deficiency in inducible nitric oxide synthase results in reduced atherosclerosis in apolipoprotein E ?eficient mice. J Immunol,2000,165:3430-3435.
27. Knowles JW, Reddick RL, Jennette JC, et al. Enhanced atherosclerosis and kidney dysfunction in eNOS (-/-) mice are ameliorated by enalapril treatment. J Clin Invest,2000,105:451-458.
28. Wang YX, Martin ?cNulty B, Huw LY, et al. Anti therosclerotic effect of simvastatin depends on presence of apolipoprotein E. Atherosclerosis,2002,162:23-31.
29. Van de Poll S, Delsing DJM, Jukema JW, et al. Raman spectroscopic investigation of atorvastatin, amlodipine, and both on atherosclerotic plaque development in APOE*3 Leiden transgenic mice. Atherosclerosis, 2002,164:65-71.
30. Siest G, Ferrari L, Accaoui MJ, et al. Pharmacogenomics of drugs affecting the cardiovascular system. Clin Chem Lab Med,2003,41(4):590-599.
31. Ye S, Huang Y, Mullendorff K, et al. Apolipoprotein (apo) E4 enhances amyloid beta peptide production in cultured neuronal cells: apoE structure as a potential therapeutic target. Proc Natl Acad Sci U S A,2005,102(51):18700-5.
32. Llaverias G, Rebollo A, Pou J, et al. Effects of rosiglitazone and atorvastatin on the expression of genes that control cholesterol homeostasis in differentiating monocytes. Biochem Pharmacol,2006,71(5):605-14.
33. Kajinami K, Akao H, Polisecki E, Schaefer EJ. Pharmacogenomics of statin responsiveness. Am J Cardiol,2005,96(9A):65K-70K.
34. Pang RW, Tam S, Janus ED, et al. Plasma lipid, lipoprotein and apolipoprotein levels in a random population sample of 2875 Hong Kong Chinese adults and their implications (NCEP ATP-III, 2001 guidelines) on cardiovascular risk assessment. Atherosclerosis,2006,184(2):438-45.
35. Fan PL,Chen CD, Kao WT, et al. Protective effect of the apo epsilon 2 allele in major depressive disorder in Taiwanese. Acta Psychiatr Scand,2006,113(1):48-53.
36. Chyu KY, Zhao X, Reyes OS, et al. Immunization using an Apo B-100 related epitope reduces atherosclerosis and plaque inflammation in hypercholesterolemic apo E (-/-) mice. Biochem Biophys Res Commun,2005,338(4),1982-9.
1. The Heart Center and the Basic Medical Center, Affiliated Beijing Chaoyang Hospital, Capital University of Medical Science, Beijing 100020, China
2. Department of Cardiology, First Affiliated Hospital, Xinjiang Medical University, Urumqi,Xinjiang 830054
3. The Department of Cardiology, Affiliated Renmin Hospital, Peking University, Beijing 100044, China
*Correspondence to Dr. Zou Yangchun, the Heart Center, Affiliated Beijing Chaoyang Hospital, Capital University of Medical Science, Beijing 100020, China,Tel/Fax:86 10 65951064,
email:yangchunzou@hotmail.com.cn
(Editor Guo Hui-ling)(ZOU Yang hun1, HONG Xiu a)