Vasectomy Influences Expression of HE1 but not HE2 and HE5 Genes in Human Epididymis
http://www.100md.com
《男科医学杂志》
the Centre de Recherche en Biologie de la Reproduction and the Département d'Obstétrique-Gynécologie, Faculté de Médecine, Université Laval, Ste-Foy, Québec, Canada.
Abstract
Epididymal roles include protection and transport, maturation, and storage of the sperm cells. It is known that these functions are altered under vasectomy, but the consequences of excurrent duct obstruction on the pattern of gene expression along the human epididymis are poorly documented. In order to understand how excurrent duct occlusion affects different epididymal regions, the expression pattern of genes known to be expressed in specific epididymal segments was investigated along the epididymides of vasectomized men. Selected human epididymal complementary DNAs (cDNAs) identified by differential library screening were studied because of their unique messenger RNA (mRNA) distribution along the different epididymal segments. In situ hybridization as well as immunohistologic studies were undertaken to investigate the effect of vasectomy on a gene expressed all along the epididymis (HE1) or more selectively in the proximal (HE2) or distal (HE5) segment. The HE1 transcript was affected by the obstruction of the epididymis with little or no mRNA detectable along the epididymis. The HE1-related antigen was shown by immunohistochemical methods to be reduced within the epithelium of the epididymis of vasectomized men. By contrast, HE5 mRNA and protein, expressed in epithelial cells of the distal epididymis, were not affected by the obstruction of the vas deferens. Similarly, HE2 transcriptional and translational products normally expressed in the caput epididymidis were not affected by vasectomy. These results show that excurrent duct obstruction differentially affects the expression pattern of some specific transcripts and their encoded proteins, probably impairing their fundamental roles in the physiology of the epididymis.
Key words: Gene expression, sperm maturation
After leaving the testis, mammalian spermatozoa must transit through the epididymis to reach the vas deferens. The epididymis is a single convoluted tubule divided in 3 segments called the caput, corpus, and cauda. The caput and corpus epididymides are involved in the acquisition of sperm fertilizing ability, whereas the cauda is the site of sperm storage (Robaire and Hermo, 1988; Hamilton, 1990). Compared to other mammalian species, the human epididymis (HE) has an unusual morphology: the caput has a bulbous appearance and a less developed cauda epididymidis (Turner, 1995). These peculiarities, together with certain clinical observations, cast doubt on the importance of epididymal transit for sperm fertilizing ability in humans (Schoysman and Bedford, 1986; Cooper, 1990).
Since the 1960s, vasectomy has been performed in nearly 100 million men for family planning purposes (Weiske, 2001). The consequences of vasectomy (excurrent duct obstruction) on the human epididymis are not well known (McDonald, 1996, 2000), most likely because the different animal models used to study vasectomy's effects on the male reproductive tract give varying results between species and even between individuals (Bedford, 1976). Accompanying the increased popularity of vasectomy has been an increased demand for surgical vasectomy reversal (vasovasostomy). The surgical success of vasovasostomy, when evaluated by recovery of normal spermogram values, can reach 85%; however, fertility recovery is much lower (Sharlip, 1993). The difficulty in regaining fertility after successful vas deferens reanastomosis can be attributed to female partner infertility, to antisperm antibodies, to epididymal obstruction by granuloma, or to idiopathic epididymal dysfunction (Silber, 1989; Belker et al, 1991; Nieschlag et al, 1997).
Our laboratory had previously described a human sperm protein, P34H, proposed to be involved in sperm binding to the egg's zona pellucida (Boué et al, 1994, 1996; Sullivan, 1999). This protein is synthesized and secreted by principal cells of the corpus epididymidis, and its location on spermatozoa is restricted to the sperm surface covering the acrosomal cap (Légaré et al, 1999). We have previously shown that P34H is always present on spermatozoa of fertile men and absent in approximately 50% of men presenting with idiopathic infertility (Boué and Sullivan, 1996). This protein can thus be considered a marker of sperm epididymal maturation in humans (Sullivan, 1999). Interestingly, P34H is also absent in a high proportion of normospermic vasovasostomized men (Guillemette et al, 1999). In situ hybridization analysis of P34H messenger RNA (mRNA) distribution showed that following vasectomy, the P34H mRNA is no longer expressed in the corpus epididymidis, its expression being shifted to the proximal caput epididymidis (Légaré et al, 2001). It thus appears that under vasectomy, the expression pattern of this gene involved in sperm maturation is modified along the human epididymis, and this can affect sperm maturation. Vasectomy has also been shown to affect expression of the cysteine-rich secretory protein (CRISP-1) in the rat caput epididymidis (Turner et al, 1999) and of the HE2-like mRNA in the corpus segment of the cynomolgus monkey (Doiron et al, 2003).
Gene expression along the epididymis is highly orchestrated, each region being characterized by a specific pattern of protein secretion. It appears that vasectomy provokes disregulation of gene expression along the excurrent duct. Understanding how vasectomy affects the epididymis may give some clues as to how gene expression is regulated along the excurrent duct. To further document the effects of vasectomy on the pattern of gene expression along the human epididymis, 3 transcripts previously shown to be expressed by human epididymis were selected with regard to their different pattern of expression: HE1, HE2, and HE5 (Kirchhoff, 1999). Even though its expression is not specific to the epididymis, HE1 was chosen because it is the most abundant gene product expressed in all the epididymal segments, excluding the most proximal part containing the efferent ducts (Krull et al, 1993). HE2 was chosen because of its expression in the distal human caput epididymidis. By opposition to HE2, HE5 mRNA was studied because it is mainly expressed in principal cells of the distal part of the epididymis. In situ hybridization and immunohistochemistry analysis were used to investigate the expression pattern of these 3 specific epididymal mRNA and proteins.
Materials and Methods
Tissue Preparation
Human epididymides were obtained through our local organ transplantation program. Epididymides under vasectomy were essentially the ones described in a previous study (Légaré et al, 2001). Unfortunately, information regarding time periods between vasectomy and tissue donation was not available, but all donors were younger than 65 years. Three donors between 20 and 39 years old with no medical pathologies that could affect reproductive function were used as controls. Tissues were obtained and processed essentially as previously described (Légaré et al, 2001). Briefly, tissues were collected under optimum conditions while artificial circulation was maintained to preserve organs assigned for transplantation. Because of geographic constraints, it was not possible to process epididymal tissues of vasectomized men on a time schedule compatible with mRNA extraction necessary to perform Northern blot analysis. Epididymides under vasectomy were identified by dissecting the scrotal portion of the vas deferens. Epididymides were dissected and immediately fixed in freshly prepared 4% (wt/vol) paraformaldehyde in phosphate-buffered saline (PBS), embedded in OCT (10.24% [wt/wt] polyvinyl alcohol, 4.26% [wt/wt] polyethylene glycol, and 85.5% [wt/wt] nonreactive ingredients; Sakura Finetek, Torrence, Calif), and stored at -80°C until used for in situ hybridization or for immunohistochemistry. Experimental procedures were approved by our local institutional ethic committee.
In Situ Hybridization
HE (complementary DNAs)— All complementary DNA (cDNA) inserts were generated by reverse transcriptase-polymerase chain reaction (RT-PCR) using poly(A)RNA from normal human epididymis. The oligonucleotide sequences used for primers were for HE1 (5' GATGGAGTTATAAAGGAAGT and 5' GCTGGAGGTGCTGTCAAGAG), for HE2 (5' GCAGTGCTCTTGGCAGACAT and 5' GCAACACCTATTCCAGGGAT), and for HE5 (5' GACAGCCACGAAGATCCTAC and 5' TGCAGTACAAGGGTAACTTT). All PCR products were subcloned into pGEM-T (Promega, Madison, Wis). All nucleotide sequences were determined by the dideoxinucleotide termination method (Sanger) using a T7 Sequenase v 2.0 kit (Amersham, Baie d'Urfée, Québec, Canada).
RNA Labeling— RNA probes were transcribed using the Digoxigenin RNA labeling technique for in vitro transcription (Roche Diagnostics, Laval, Québec, Canada). Briefly, plasmids were digested with appropriate restriction endonucleases downstream from the target DNA insert. mRNA was transcribed using SP6 and T7 RNA polymerase (Roche) in the presence of Digoxigenin-11-uridire-triphosphate (DIG)-UTP.
Fixation and Pretreament of Sections— Epididymis cryosections were fixed with freshly prepared 4% (wt/vol) paraformaldehyde in PBS for 5 minutes at room temperature, incubated for 10 minutes in 95% ethanol/5% acetic acid at -20°C, and rehydrated in successive baths of decreasing concentrations of ethanol diluted with diethylpyrocarbonate (DEPC)-treated water. Target RNAs were unmasked by enzymatic digestion with 10 μg/mL proteinase K (Roche) in PBS for 10 minutes at 37°C and then incubated for 5 minutes in 0.2% glycine. Sections were postfixed for 5 minutes with 4% paraformaldehyde in PBS, acetylated with 0.25% acetic anhydride, 0.1 M triethanolamine, pH 8.0, for 10 minutes, and finally washed with PBS.
Hybridization— Tissues were prehybridized for 2 hours at 42°C, with 250 μg/mL salmon sperm DNA preheated in a hybridization solution (0.3 M NaCl, 0.01 M Tris-HCl, pH 7.5, 1 mM EDTA, and 1x Denhardt solution) (0.2% [wt/vol] Ficoll 400, 0.2% [wt/vol] polyvinylpyrrolidone, 0.2% [wt/vol] bovine serum albumin [BSA], 5% dextran sulfate, 0.02% sodium dodecyl sulfate, and 50% formamide). Sections were then incubated overnight at 42°C, under coverslips, with 25 μL of 5 μg/mL heat-denatured antisense or sense HE1, HE2, or HE5 chromosomal RNA (cRNA) probed with DIG (Roche) according to supplier's instructions. Sections were washed twice in 2x SSC at room temperature, and this was followed by two 10-minute washes at 42°C in 2x SSC, 1x SSC, and 0.2x SSC.
Immunodectection— Hybridization reactions were detected by immunostaining with alkaline phosphatase-conjugated DIG antibodies (Roche). Nonspecific staining was blocked by preincubation for 1 hour with 5% (vol/vol) heat-inactivated sheep serum in Tris-HCl/NaCl buffer (0.2 M Tris-HCl, 0.2 M NaCl, and 0.3% Triton X-100). Sections were then incubated for 2 hours at room temperature with the alkaline phosphatase-conjugated anti-DIG antibodies diluted 1:1000 in blocking solution, washed with Tris-HCl/NaCl buffer, and incubated with 0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, and 0.01 M MgCl2. The hybridization signal was visualized after a 10- to 15-minute incubation period with the phosphatase substrate, nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate p-toluidine salt (GIBCO-BRL, Gaithersburg, Md). Levamisole (2 mM; Sigma Chemical Co, St Louis, Mo) was added to the reaction mixture to inhibit endogenous alkaline phosphatase. Microscopic slides were immersed in 1 mM EDTA and 10 mM Tris-HCl, pH 7.5, washed 5 minutes in H2O, counterstained with neutral red, dehydrated through baths of ethanol, cleared in xylene, and mounted with Permount (Fisher Scientific, Nepean, Ontario, Canada). Epididymis sections from control and vasectomized men were processed in parallel to allow comparison.
Antibodies
Rabbit polyclonal antibody against ram HE1/CTP (human epididymal 1/cholesterol transfert protein) was a kind gift of Dr Jean-Luc Gatti (Fouchecourt et al, 2000) and used at a 7500-fold dilution for immunostaining. Rabbit polyclonal antibodies directed against 2 peptides (P3 and P4) synthesized according to the HE2 cDNA sequences were a kind gift of Dr Christiane Kirchhoff. Anti-P3 (HE2/HE2?-specific) and P4 (HE2?1/HE2E-specific) antisera reacting with 2 different HE2 isoforms (von Horsten et al, 2002) were used at a 200-fold dilution. Rat monoclonal antibody against human-CD52 antigen (CAMPATH-1) was purchased from Cederlane (Hornby, Ontario, Canada) and used at a 25-fold dilution. Biotinylated goat anti-rabbit secondary antibody was obtained from Dako Diagnostics (Mississauga, Ontario, Canada), and biotinylated goat anti-rat secondary antibody was purchased from Jackson Immunoresearch Laboratories (West Grove, Pa).
Immunohistochemical Staining
Cryostat cross sections (10 μm) were prepared from frozen epididymal tissues. Endogenous peroxidase activity was quenched with 3% H2O2 (vol/vol) in PBS for 30 minutes. Nonspecific binding sites were then blocked with 10% goat serum in PBS for 1 hour. The HE1-, HE2-, or CD52-specific antibodies were diluted in PBS and applied overnight at 4°C. In control sections, the primary antibodies were replaced by the corresponding nonspecific immunoglobulin G (IgG) or preimmune serum (rabbit IgG for HE1 or preimmune serum for HE2 and rat IgG for CD52) and processed in parallel. Sections were subsequently incubated with biotinylated goat anti-rabbit or goat anti-rat secondary antibody for 30 minutes and with avidin-biotin complex reagent for 30 minutes. Immunostaining was shown using 3-amino-9-ethylcarbazole (AEC). Harris hematoxylin was used for counterstaining and mounted under a coverslip using an aqueous mounting medium (Sigma). Slides were observed under a Zeiss Axioskop2 Plus microscope (Toronto, Ontario, Canada) linked to a digital camera from Diagnostics Instruments (Sterling Heights, Mich). Images were captured using the Spot software (Diagnostics) and analyzed with Image-Pro Plus from Media Cybernetics (Silver Springs, Md).
Image Analysis
All experiments were performed on specimens at least 3 times that included normal epididymis control sections. Five images per section were digitalized. Areas of interest were separately cropped and then submitted to densitometry analysis for quantification as already described by Doiron et al (2003). Color-cube-based segmentation was used to select only shades of blue (in situ hybridization) or red (immunohistochemistry) in the area of interest. Integrated optical density (IOD) of the blue or the red staining was measured after standard OD calibration. Results were expressed in OD units. All data were presented as mean (±SEM). Statistical analysis was performed by analysis of variance using super ANOVA software (ABACUS Concepts, Berkeley, Calif). Results were compared by the Student-Newman-Keuls test. Differences were considered significant at P-values <.05.
Results
Expression Patterns of the HE1 mRNA and Protein
In situ hybridization analysis was used to investigate the tissue distribution of human HE1 mRNA in epididymides of normal and vasectomized men. A PCR fragment (431 bp) showing 100% identity with HE1 cDNA (Kirchhoff et al, 1996) was used as a hybridization probe (data not shown). As shown in Figure 1, in normal tissues, HE1 mRNA was highly detected in the epithelial cells of the caput, corpus, and cauda segments of the epididymis. This transcript showed a basal distribution within the cytoplasm of the principal cells. No signal was detected in the efferent duct (data not shown). This expression pattern along the excurrent duct was consistent with the results reported by Kirchhoff (1998). In the vasectomized specimens, the level of HE1 mRNA was greatly reduced all along the epididymis. Very weak or nonexistent hybridization signals were detectable in the epididymal duct epithelium (Figure 1).
To identify the presence of HE1 protein in the epididymides of normal and vasectomized men, immunohistochemistry analysis was carried out using a polyclonal anti-HE1 antibody (Figure 2). As previously described, HE1 protein was detectable in large amounts within the epithelium of the normal human caput, corpus, and cauda epididymides (Kirchhoff et al, 1996). HE1 staining was more intense in the cytoplasm at the apical side of the epithelium. Following vasectomy, the presence of HE1 protein along the epididymis was greatly altered; the staining intensity was tremendously decreased (Figure 2). No reactivity was observed when preimmune serum was used as a negative control (Figure 2G and H).
Expression Patterns of HE2 and HE5 mRNAs and Proteins
The tissue distribution of human HE2 and HE5 mRNAs in the epididymides of normal and vasectomized men was investigated by using a PCR fragment of 359 and 421 bp, respectively (showing 100% identity with HE2 and HE5 cDNAs) (Kirchhoff et al, 1993; Osterhoff et al, 1994), as in situ probes. In contrast to HE1, vasectomy did not affect the distribution or the level of HE2 and HE5 mRNA expression along the human epididymis (Figures 3 and 4). In both normal and vasectomized epididymal tissues, HE2 transcript was expressed in the caput epididymal epithelium. By contrast, HE5 mRNA was predominantly expressed by the epithelial cells of the corpus epididymidis. Both transcripts were predominant in the basal cytoplasm compartment of the principal cells. In all in situ hybridizations performed, no positive signal was observed in the interstitial epididymal tissues. Nor was any signal detected when HE2 or HE5 sense cRNA probes were used as negative controls (Figure 3G and H; Figure 4G and H).
Immunohistologic techniques were used to document the distribution of HE2 and HE5 translational products and the possible effect of vasectomy on their respective localization. As for the transcripts, the protein distribution along the epididymides was not affected by vasectomy. When probed with the anti-P4 peptide antiserum (HE2?1/HE2E-specific), the major peptide isoform in the human epididymis, HE2 was strongly detectable in the cytoplasm of the caput and corpus epididymal epithelium with some labeling in the intraluminal compartment (Figure 5). Similar results were obtained when immunohistologic staining of HE2 was performed using the antiserum raised against the P3 peptide (data not shown). In both intact and vasectomized epididymides, HE5 was uniformly distributed within the cytoplasm of the human epididymal principal cells as described by Kirchhoff et al (1993). The staining signal was more intense in the corpus epididymidis (Figure 6C and D). For both HE2 and HE5 immunodetection, no signal was detectable when preimmune sera or control IgGs were used as negative controls (Figure 5G and H; Figure 6G and H).
Figure 6. Immunohistochemical localization of human epididymal 5 (HE5) in normal (A, C, and E) and vasectomized (B, D, and F) human epididymides. Immunoperoxidase staining of tissue sections was performed employing the anti-HE5 antibody. Red staining shows the presence of HE5 in (A, B) caput, (C, D) corpus, and (E, F) cauda epididymidis. Negative controls: (G) normal corpus region and (H) corpus region under vasectomy incubated with a preimmune serum. Tissues were counterstained in blue with Harris hematoxylin.
In Situ Hybridization and Immunohistochemistry Quantification
Highly reproducible image analysis software was used to quantify HE expression (Doiron et al, 2003). Densitometric quantification of in situ hybridization and immunohistologic staining clearly indicated that, by opposition to HE2 and HE5, only HE1 transcriptional and translational products were affected by vasectomy. When compared to values characterizing normal epididymides, HE1 mRNA and protein were significantly diminished under vasectomy, with P-values <.05 (Figure 7).
Figure 7. Quantification of in situ hybridization (A, C, and E) and immunohistochemistry (B, D, and F) detection of human epididymal 1 (HE1) (A, B), human epididymal 2 (HE2) (C, D), and human epididymal 5 (HE5) (E, F) along the normal and vasectomized human epididymides. Quantification was performed by densitometry expressed as "relative intensity" units (RI). All data are presented as the mean (±SEM). Designations () are significantly different at P < .05.
Discussion
The acquisition of sperm fertilizing ability depends on well-coordinated interactions between the sperm surface and the epididymal intraluminal microenvironment (Cooper, 1998). The composition of the intraluminal fluid is modulated by reabsorption of seminiferous constituents, selective transport of serum molecules, and secretory activity of the epididymal epithelium (Hermo et al, 1994). The protein composition of intraluminal fluid shows great variability along the epididymis, which is a consequence of different patterns of gene expression along the excurrent duct (Dacheux and Dacheux, 2002). The factors that modulate gene expression in different epididymal segments remain to be defined (Cornwall and Hann, 1995; Kirchhoff, 1999; Rodriguez et al, 2001). After vasectomy, the transcription of selected genes appears to be affected in men (Turner et al, 1999; Légaré et al, 2001). Indeed, not all transcripts are affected by vasectomy as demonstrated with HE2 and HE5. However, some transcripts are expressed in another location (P34H) (Légaré et al, 2001), and others almost completely disappear (HE1) (Figure 8). Effects of mRNA expression pattern modifications along the epididymis could affect the maturational process of spermatozoa if the proteins encoded by the affected transcripts are necessary for sperm function or maturational biochemical surface modifications. If these modifications of gene expression pattern persist following vasovasostomy, this could explain the much lower than expected fertility rate with regard to the surgical success of vas reanastomosis.
Figure 8. Relative levels of human epididymal 1 (HE1), human epididymal 2 (HE2), human epididymal 5 (HE5), and the human sperm protein P34H messenger RNAs (mRNAs) along the human epididymis of normal (above the horizontal line) and vasectomized (under the horizontal line) men. P34H mRNA distribution is drawn according to Légaré et al (2001).
Some modifications in mRNA and protein synthesis that occur after vasectomy persist after successful vasovasostomy. In the rat, vasectomy affects the overall pattern of protein synthesis and secretion in the caput epididymidis, including CRISP-1 (Turner et al, 1999). The reduction in CRISP-1 secretion in the caput lumen persists following successful vasovasostomy (Turner et al, 2000). Because it is involved in the mechanism of sperm-egg plasma membrane fusion, CRISP-1 is a critical protein in sperm maturation (Cuasnicu et al, 1999). P34H is a human epididymal protein involved in the acquisition of the ability to interact with the zona pellucida by the maturing spermatozoa (Boué et al, 1994). Whereas the pattern of P34H mRNA expression along the epididymis is altered in vasectomized men, this protein is absent on the spermatozoa of an important percentage of normospermic vasovasostomized men (Guillemette et al, 1999), and the absence of P34H has been associated with male infertility (Boué and Sullivan, 1996; Sullivan, 1999). The amounts of HE1 mRNA and protein are dramatically decreased under vasectomy. Whether or not HE1 levels remain low following vas deferens reanastomosis in vasectomized men is unknown. After ejaculation, HE1 seems to be present in the seminal plasma, but only loosely bound to sperm (Kirchhoff et al, 1996). HE1 sequence shows similarity with a protein purified from ram epididymal fluid (Baker et al, 1993; Okamura et al, 1999) as well as with the NPC2 gene (Ko et al, 2003). These have been shown to function as cholesterol-transfer proteins. Therefore, HE1 may represent a decapacitation factor that regulates the cholesterol content of sperm during maturation, storage, and capacitation (Kirchhoff et al, 1997). In this regard, it would be interesting to compare the cholesterol content of spermatozoa from normal and vasovasostomized men. As for P34H, HE1 could thus be a good indicator of the epididymal sequelae remaining after vasovasostomy in men.
The 3 HE mRNAs and proteins investigated in this study have been selected according to their different expression pattern along the epididymis. HE2 and HE5 were previously reported to be expressed in the proximal and distal regions of the normal human epididymis, respectively (Krull et al, 1993; Kirchhoff, 1999). Our data are in accordance with these reports and show that vasectomy does not affect the level of transcription or the distribution of these epididymal mRNAs. On the other hand, HE1, which shows its maximum expression in the median region of the epididymis, is greatly affected by vasectomy. Like HE1, P34H, which is strongly expressed in the corpus epididymis, is also affected by vasectomy (Légaré et al, 2001). This may suggest that the median region of the epididymis is more "sensitive" to modifications triggered by vasectomy than the proximal caput and distal cauda epididymides. This appears to be the case in cynomolgus monkeys, a species in which vasectomy down-regulates HE2 expression in the corpus region (Doiron et al, 2003). On the other hand, caput epididymidis protein secretion is greatly affected by vasectomy in the rat (Turner et al, 2000). Obviously, epididymal sequelae following vasectomy show species-related differences (Bedford, 1976). Another possibility is that some genes are more responsive to intraluminal changes occurring under vasectomy than others. During vasectomy in man, the height of epididymal epithelium is greatly decreased (Légaré et al, 2001). This is a consequence of the increased intraluminal pressure (Johnson and Howards, 1975) caused by the local accumulation of fluid. Another consequence of fluid accumulation is the modification of lumicrine factor composition of testicular origin (Turner et al, 1999). The consequences for the epithelial functions could be represented by the observed modifications of synthesis and secretion of specific proteins such as HE1 or P34H (Figure 8). The molecular mechanisms responsible for these specific changes remain to be determined. Understanding how vasectomy affects the epididymis will contribute to further comprehension of the control mechanisms of gene expression along the excurrent duct in men.
Acknowledgments
We wish to thank Dr Franck Boué for assistance in tissue preparation, Québec Transplant for their collaboration, and Dr Fabrice Saez for valuable comments and criticisms of the manuscript. We thank Dr Jean-Luc Gatti (UMR6073 INRA-CNRS, Nouzilly, France) for providing the rabbit polyclonal antibody against ram HE1/CTP and Dr Christiane Kirchhoff (University of Hamburg, Germany) for the kind gift of antisera raised against HE2 peptides.
Footnotes
Supported by a Canadian Institutes for Health Research grant (R.S.).
References
Baker C, Magargee S, Hammerstedt R. Cholesterol transfer proteins from ram cauda epididymal and seminal plasma. Biol Reprod. 1993;48(suppl 1):111.
Bedford JM. Adaptations of the male reproductive tract and the fate of spermatozoa following vasectomy in the rabbit, rhesus monkey, hamster and rat. Biol Reprod. 1976; 14:118-142.
Belker AM, Thomas AJ Jr, Fuchs EF, Konnak JW, Sharlip ID. Results of 1,469 microsurgical vasectomy reversals by the Vasovasostomy Study Group. J Urol. 1991;145:505-511.
Boué F, Berube B, De Lamirande E, Gagnon C, Sullivan R. Human sperm-zona pellucida interaction is inhibited by an antiserum against a hamster sperm protein. Biol Reprod. 1994; 51:577-587.
Boué F, Blais J, Sullivan R. Surface localization of P34H, an epididymal protein, during maturation, capacitation, and acrosome reaction of human spermatozoa. Biol Reprod. 1996; 54:1009-1017.
Boué F, Sullivan R. Cases of human infertility are associated with the absence of P34H, an epididymal sperm antigen. Biol Reprod. 1996; 54:1018-1024.
Cooper TG. In defense of a function for the human epididymis. Fertil Steril. 1990; 54:965-975.
Cooper TG. Interactions between epididymal secretions and spermatozoa. J Reprod Fertil. 1998; 53(suppl):119-136.
Cornwall GA, Hann SR. Specialized gene expression in the epididymis. J Androl. 1995; 16:379-383.
Cuasnicu P, Cohen D, Ellerman D. Participation of epididymal protein "DE" and its egg binding sites in sperm-egg fusion. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:267-272.
Dacheux J, Dacheux F. Protein secretion in the epididymis. In: Hinton IBRaB, ed. The Epididymis. New York, NY: Kluwer Academic/Plenum Publishers; 2002:151-168.
Doiron K, Légaré C, Saez F, Sullivan R. Effect of vasectomy on gene expression in the epididymis of cynomolgus monkey. Biol Reprod. 2003; 68:781-788.
Fouchecourt S, Metayer S, Locatelli A, Dacheux F, Dacheux JL. Stallion epididymal fluid proteome: qualitative and quantitative characterization; secretion and dynamic changes of major proteins. Biol Reprod. 2000; 62:1790-1803.
Guillemette C, Thabet M, Dompierre L, Sullivan R. Some vasovasostomized men are characterized by low levels of P34H, an epididymal sperm protein. J Androl. 1999; 20:214-219.
Hamilton DW. Anatomy of mammalian male accessory reproductive organs. In: Lamming G, ed. Marshall's Physiology of Reproduction. Edinburg, United Kingdom: Churchill-Livingstone; 1990 : 691-746.
Hermo L, Oko R, Morales CR. Secretion and endocytosis in the male reproductive tract: a role in sperm maturation. Int Rev Cytol. 1994;154:106-189.
Johnson AL, Howards SS. Intratubular hydrostatic pressure in testis and epididymis before and after vasectomy. Am J Physiol. 1975;228:556-564.
Kirchhoff C. Molecular characterization of epididymal proteins. Rev Reprod. 1998; 3:86-95.
Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188:133-202.
Kirchhoff C, Krull N, Pera I, Ivell R. A major mRNA of the human epididymal principal cells, HE5, encodes the leucocyte differentiation CDw52 antigen peptide backbone. Mol Reprod Dev. 1993; 34:8-15.
Kirchhoff C, Osterhoff C, Young L. Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod. 1996; 54:847-856.
Kirchhoff C, Pera I, Derr P, Yeung CH, Cooper T. The molecular biology of the sperm surface. Post-testicular membrane remodelling. Adv Exp Med Biol. 1997; 424:221-232.
Ko DC, Binkley J, Sidow A, Scott MP. The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels. Proc Natl Acad Sci U S A. 2003; 100:2518-2525.
Krull N, Ivell R, Osterhoff C, Kirchhoff C. Region-specific variation of gene expression in the human epididymis as revealed by in situ hybridization with tissue-specific cDNAs. Mol Reprod Dev. 1993;34:16-24.
Légaré C, Gaudreault C, St-Jacques S, Sullivan R. P34H sperm protein is preferentially expressed by the human corpus epididymidis. Endocrinology. 1999; 140:3318-3327.
Légaré C, Thabet M, Picard S, Sullivan R. Effect of vasectomy on P34H messenger ribonucleic acid expression along the human excurrent duct: a reflection on the function of the human epididymis. Biol Reprod. 2001; 64:720-727.
McDonald SW. Vasectomy review: sequelae in the human epididymis and ductus deferens. Clin Anat. 1996; 9:337-342.
McDonald SW. Cellular responses to vasectomy. Int Rev Cytol. 2000;199:295-339.
Nieschlag A, Behre H, Engelmann U, Hertle L. Male contribution to contraception. In: Nieschlag E, Behre HM, eds. Male Reproductive Health and Dysfunction. Berlin: Springer; 1997:377-393.
Okamura N, Kiuchi S, Tamba M, et al. A porcine homolog of the major secretory protein of human epididymis, HE1, specifically binds cholesterol. Biochim Biophys Acta. 1999; 1438:377-387.
Osterhoff C, Kirchhoff C, Krull N, Ivell R. Molecular cloning and characterization of a novel human sperm antigen (HE2) specifically expressed in the proximal epididymis. Biol Reprod. 1994; 50:516-525.
Robaire B, Hermo L. Efferent ducts, epididymis and vas deferens: structure, functions and their regulation. In: Knobil E, O'Neill J, eds. The Physiology of Reproduction. 1st ed. New York, NY: Raven Press; 1988: 999-1080.
Rodriguez CM, Kirby JL, Hinton BT. Regulation of gene transcription in the epididymis. Reproduction. 2001; 122:41-48.
Schoysman RJ, Bedford JM. The role of the human epididymis in sperm maturation and sperm storage as reflected in the consequences of epididymovasostomy. Fertil Steril. 1986; 46:293-299.
Sharlip ID. What is the best pregnancy rate that may be expected from vasectomy reversal? J Urol. 1993; 149:1469-1471.
Silber SJ. Pregnancy after vasovasostomy for vasectomy reversal: a study of factors affecting long-term return of fertility in 282 patients followed for 10 years. Hum Reprod. 1989; 4:318-322.
Sullivan R. Interaction between sperm and epididymal secretory proteins. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:93-104.
Turner TT. On the epididymis and its role in the development of the fertile ejaculate. J Androl. 1995; 16:292-298.
Turner TT, Riley TA, Mruk DD, Cheng CY. Obstruction of the vas deferens alters protein secretion by the rat caput epididymidal epithelium in vivo. J Androl. 1999; 20:289-297.
Turner TT, Riley TA, Vagnetti M, Flickinger CJ, Caldwell JA, Hunt DF. Postvasectomy alterations in protein synthesis and secretion in the rat caput epididymidis are not repaired after vasovasostomy. J Androl. 2000;21:276-290.
von Horsten HH, Derr P, Kirchhoff C. Novel antimicrobial peptide of human epididymal duct origin. Biol Reprod. 2002; 67:804-813.
Weiske WH. Vasectomy. Andrologia. 2001; 33:125-134.(CHRISTINE LéGARé, NANCY V)
Abstract
Epididymal roles include protection and transport, maturation, and storage of the sperm cells. It is known that these functions are altered under vasectomy, but the consequences of excurrent duct obstruction on the pattern of gene expression along the human epididymis are poorly documented. In order to understand how excurrent duct occlusion affects different epididymal regions, the expression pattern of genes known to be expressed in specific epididymal segments was investigated along the epididymides of vasectomized men. Selected human epididymal complementary DNAs (cDNAs) identified by differential library screening were studied because of their unique messenger RNA (mRNA) distribution along the different epididymal segments. In situ hybridization as well as immunohistologic studies were undertaken to investigate the effect of vasectomy on a gene expressed all along the epididymis (HE1) or more selectively in the proximal (HE2) or distal (HE5) segment. The HE1 transcript was affected by the obstruction of the epididymis with little or no mRNA detectable along the epididymis. The HE1-related antigen was shown by immunohistochemical methods to be reduced within the epithelium of the epididymis of vasectomized men. By contrast, HE5 mRNA and protein, expressed in epithelial cells of the distal epididymis, were not affected by the obstruction of the vas deferens. Similarly, HE2 transcriptional and translational products normally expressed in the caput epididymidis were not affected by vasectomy. These results show that excurrent duct obstruction differentially affects the expression pattern of some specific transcripts and their encoded proteins, probably impairing their fundamental roles in the physiology of the epididymis.
Key words: Gene expression, sperm maturation
After leaving the testis, mammalian spermatozoa must transit through the epididymis to reach the vas deferens. The epididymis is a single convoluted tubule divided in 3 segments called the caput, corpus, and cauda. The caput and corpus epididymides are involved in the acquisition of sperm fertilizing ability, whereas the cauda is the site of sperm storage (Robaire and Hermo, 1988; Hamilton, 1990). Compared to other mammalian species, the human epididymis (HE) has an unusual morphology: the caput has a bulbous appearance and a less developed cauda epididymidis (Turner, 1995). These peculiarities, together with certain clinical observations, cast doubt on the importance of epididymal transit for sperm fertilizing ability in humans (Schoysman and Bedford, 1986; Cooper, 1990).
Since the 1960s, vasectomy has been performed in nearly 100 million men for family planning purposes (Weiske, 2001). The consequences of vasectomy (excurrent duct obstruction) on the human epididymis are not well known (McDonald, 1996, 2000), most likely because the different animal models used to study vasectomy's effects on the male reproductive tract give varying results between species and even between individuals (Bedford, 1976). Accompanying the increased popularity of vasectomy has been an increased demand for surgical vasectomy reversal (vasovasostomy). The surgical success of vasovasostomy, when evaluated by recovery of normal spermogram values, can reach 85%; however, fertility recovery is much lower (Sharlip, 1993). The difficulty in regaining fertility after successful vas deferens reanastomosis can be attributed to female partner infertility, to antisperm antibodies, to epididymal obstruction by granuloma, or to idiopathic epididymal dysfunction (Silber, 1989; Belker et al, 1991; Nieschlag et al, 1997).
Our laboratory had previously described a human sperm protein, P34H, proposed to be involved in sperm binding to the egg's zona pellucida (Boué et al, 1994, 1996; Sullivan, 1999). This protein is synthesized and secreted by principal cells of the corpus epididymidis, and its location on spermatozoa is restricted to the sperm surface covering the acrosomal cap (Légaré et al, 1999). We have previously shown that P34H is always present on spermatozoa of fertile men and absent in approximately 50% of men presenting with idiopathic infertility (Boué and Sullivan, 1996). This protein can thus be considered a marker of sperm epididymal maturation in humans (Sullivan, 1999). Interestingly, P34H is also absent in a high proportion of normospermic vasovasostomized men (Guillemette et al, 1999). In situ hybridization analysis of P34H messenger RNA (mRNA) distribution showed that following vasectomy, the P34H mRNA is no longer expressed in the corpus epididymidis, its expression being shifted to the proximal caput epididymidis (Légaré et al, 2001). It thus appears that under vasectomy, the expression pattern of this gene involved in sperm maturation is modified along the human epididymis, and this can affect sperm maturation. Vasectomy has also been shown to affect expression of the cysteine-rich secretory protein (CRISP-1) in the rat caput epididymidis (Turner et al, 1999) and of the HE2-like mRNA in the corpus segment of the cynomolgus monkey (Doiron et al, 2003).
Gene expression along the epididymis is highly orchestrated, each region being characterized by a specific pattern of protein secretion. It appears that vasectomy provokes disregulation of gene expression along the excurrent duct. Understanding how vasectomy affects the epididymis may give some clues as to how gene expression is regulated along the excurrent duct. To further document the effects of vasectomy on the pattern of gene expression along the human epididymis, 3 transcripts previously shown to be expressed by human epididymis were selected with regard to their different pattern of expression: HE1, HE2, and HE5 (Kirchhoff, 1999). Even though its expression is not specific to the epididymis, HE1 was chosen because it is the most abundant gene product expressed in all the epididymal segments, excluding the most proximal part containing the efferent ducts (Krull et al, 1993). HE2 was chosen because of its expression in the distal human caput epididymidis. By opposition to HE2, HE5 mRNA was studied because it is mainly expressed in principal cells of the distal part of the epididymis. In situ hybridization and immunohistochemistry analysis were used to investigate the expression pattern of these 3 specific epididymal mRNA and proteins.
Materials and Methods
Tissue Preparation
Human epididymides were obtained through our local organ transplantation program. Epididymides under vasectomy were essentially the ones described in a previous study (Légaré et al, 2001). Unfortunately, information regarding time periods between vasectomy and tissue donation was not available, but all donors were younger than 65 years. Three donors between 20 and 39 years old with no medical pathologies that could affect reproductive function were used as controls. Tissues were obtained and processed essentially as previously described (Légaré et al, 2001). Briefly, tissues were collected under optimum conditions while artificial circulation was maintained to preserve organs assigned for transplantation. Because of geographic constraints, it was not possible to process epididymal tissues of vasectomized men on a time schedule compatible with mRNA extraction necessary to perform Northern blot analysis. Epididymides under vasectomy were identified by dissecting the scrotal portion of the vas deferens. Epididymides were dissected and immediately fixed in freshly prepared 4% (wt/vol) paraformaldehyde in phosphate-buffered saline (PBS), embedded in OCT (10.24% [wt/wt] polyvinyl alcohol, 4.26% [wt/wt] polyethylene glycol, and 85.5% [wt/wt] nonreactive ingredients; Sakura Finetek, Torrence, Calif), and stored at -80°C until used for in situ hybridization or for immunohistochemistry. Experimental procedures were approved by our local institutional ethic committee.
In Situ Hybridization
HE (complementary DNAs)— All complementary DNA (cDNA) inserts were generated by reverse transcriptase-polymerase chain reaction (RT-PCR) using poly(A)RNA from normal human epididymis. The oligonucleotide sequences used for primers were for HE1 (5' GATGGAGTTATAAAGGAAGT and 5' GCTGGAGGTGCTGTCAAGAG), for HE2 (5' GCAGTGCTCTTGGCAGACAT and 5' GCAACACCTATTCCAGGGAT), and for HE5 (5' GACAGCCACGAAGATCCTAC and 5' TGCAGTACAAGGGTAACTTT). All PCR products were subcloned into pGEM-T (Promega, Madison, Wis). All nucleotide sequences were determined by the dideoxinucleotide termination method (Sanger) using a T7 Sequenase v 2.0 kit (Amersham, Baie d'Urfée, Québec, Canada).
RNA Labeling— RNA probes were transcribed using the Digoxigenin RNA labeling technique for in vitro transcription (Roche Diagnostics, Laval, Québec, Canada). Briefly, plasmids were digested with appropriate restriction endonucleases downstream from the target DNA insert. mRNA was transcribed using SP6 and T7 RNA polymerase (Roche) in the presence of Digoxigenin-11-uridire-triphosphate (DIG)-UTP.
Fixation and Pretreament of Sections— Epididymis cryosections were fixed with freshly prepared 4% (wt/vol) paraformaldehyde in PBS for 5 minutes at room temperature, incubated for 10 minutes in 95% ethanol/5% acetic acid at -20°C, and rehydrated in successive baths of decreasing concentrations of ethanol diluted with diethylpyrocarbonate (DEPC)-treated water. Target RNAs were unmasked by enzymatic digestion with 10 μg/mL proteinase K (Roche) in PBS for 10 minutes at 37°C and then incubated for 5 minutes in 0.2% glycine. Sections were postfixed for 5 minutes with 4% paraformaldehyde in PBS, acetylated with 0.25% acetic anhydride, 0.1 M triethanolamine, pH 8.0, for 10 minutes, and finally washed with PBS.
Hybridization— Tissues were prehybridized for 2 hours at 42°C, with 250 μg/mL salmon sperm DNA preheated in a hybridization solution (0.3 M NaCl, 0.01 M Tris-HCl, pH 7.5, 1 mM EDTA, and 1x Denhardt solution) (0.2% [wt/vol] Ficoll 400, 0.2% [wt/vol] polyvinylpyrrolidone, 0.2% [wt/vol] bovine serum albumin [BSA], 5% dextran sulfate, 0.02% sodium dodecyl sulfate, and 50% formamide). Sections were then incubated overnight at 42°C, under coverslips, with 25 μL of 5 μg/mL heat-denatured antisense or sense HE1, HE2, or HE5 chromosomal RNA (cRNA) probed with DIG (Roche) according to supplier's instructions. Sections were washed twice in 2x SSC at room temperature, and this was followed by two 10-minute washes at 42°C in 2x SSC, 1x SSC, and 0.2x SSC.
Immunodectection— Hybridization reactions were detected by immunostaining with alkaline phosphatase-conjugated DIG antibodies (Roche). Nonspecific staining was blocked by preincubation for 1 hour with 5% (vol/vol) heat-inactivated sheep serum in Tris-HCl/NaCl buffer (0.2 M Tris-HCl, 0.2 M NaCl, and 0.3% Triton X-100). Sections were then incubated for 2 hours at room temperature with the alkaline phosphatase-conjugated anti-DIG antibodies diluted 1:1000 in blocking solution, washed with Tris-HCl/NaCl buffer, and incubated with 0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, and 0.01 M MgCl2. The hybridization signal was visualized after a 10- to 15-minute incubation period with the phosphatase substrate, nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate p-toluidine salt (GIBCO-BRL, Gaithersburg, Md). Levamisole (2 mM; Sigma Chemical Co, St Louis, Mo) was added to the reaction mixture to inhibit endogenous alkaline phosphatase. Microscopic slides were immersed in 1 mM EDTA and 10 mM Tris-HCl, pH 7.5, washed 5 minutes in H2O, counterstained with neutral red, dehydrated through baths of ethanol, cleared in xylene, and mounted with Permount (Fisher Scientific, Nepean, Ontario, Canada). Epididymis sections from control and vasectomized men were processed in parallel to allow comparison.
Antibodies
Rabbit polyclonal antibody against ram HE1/CTP (human epididymal 1/cholesterol transfert protein) was a kind gift of Dr Jean-Luc Gatti (Fouchecourt et al, 2000) and used at a 7500-fold dilution for immunostaining. Rabbit polyclonal antibodies directed against 2 peptides (P3 and P4) synthesized according to the HE2 cDNA sequences were a kind gift of Dr Christiane Kirchhoff. Anti-P3 (HE2/HE2?-specific) and P4 (HE2?1/HE2E-specific) antisera reacting with 2 different HE2 isoforms (von Horsten et al, 2002) were used at a 200-fold dilution. Rat monoclonal antibody against human-CD52 antigen (CAMPATH-1) was purchased from Cederlane (Hornby, Ontario, Canada) and used at a 25-fold dilution. Biotinylated goat anti-rabbit secondary antibody was obtained from Dako Diagnostics (Mississauga, Ontario, Canada), and biotinylated goat anti-rat secondary antibody was purchased from Jackson Immunoresearch Laboratories (West Grove, Pa).
Immunohistochemical Staining
Cryostat cross sections (10 μm) were prepared from frozen epididymal tissues. Endogenous peroxidase activity was quenched with 3% H2O2 (vol/vol) in PBS for 30 minutes. Nonspecific binding sites were then blocked with 10% goat serum in PBS for 1 hour. The HE1-, HE2-, or CD52-specific antibodies were diluted in PBS and applied overnight at 4°C. In control sections, the primary antibodies were replaced by the corresponding nonspecific immunoglobulin G (IgG) or preimmune serum (rabbit IgG for HE1 or preimmune serum for HE2 and rat IgG for CD52) and processed in parallel. Sections were subsequently incubated with biotinylated goat anti-rabbit or goat anti-rat secondary antibody for 30 minutes and with avidin-biotin complex reagent for 30 minutes. Immunostaining was shown using 3-amino-9-ethylcarbazole (AEC). Harris hematoxylin was used for counterstaining and mounted under a coverslip using an aqueous mounting medium (Sigma). Slides were observed under a Zeiss Axioskop2 Plus microscope (Toronto, Ontario, Canada) linked to a digital camera from Diagnostics Instruments (Sterling Heights, Mich). Images were captured using the Spot software (Diagnostics) and analyzed with Image-Pro Plus from Media Cybernetics (Silver Springs, Md).
Image Analysis
All experiments were performed on specimens at least 3 times that included normal epididymis control sections. Five images per section were digitalized. Areas of interest were separately cropped and then submitted to densitometry analysis for quantification as already described by Doiron et al (2003). Color-cube-based segmentation was used to select only shades of blue (in situ hybridization) or red (immunohistochemistry) in the area of interest. Integrated optical density (IOD) of the blue or the red staining was measured after standard OD calibration. Results were expressed in OD units. All data were presented as mean (±SEM). Statistical analysis was performed by analysis of variance using super ANOVA software (ABACUS Concepts, Berkeley, Calif). Results were compared by the Student-Newman-Keuls test. Differences were considered significant at P-values <.05.
Results
Expression Patterns of the HE1 mRNA and Protein
In situ hybridization analysis was used to investigate the tissue distribution of human HE1 mRNA in epididymides of normal and vasectomized men. A PCR fragment (431 bp) showing 100% identity with HE1 cDNA (Kirchhoff et al, 1996) was used as a hybridization probe (data not shown). As shown in Figure 1, in normal tissues, HE1 mRNA was highly detected in the epithelial cells of the caput, corpus, and cauda segments of the epididymis. This transcript showed a basal distribution within the cytoplasm of the principal cells. No signal was detected in the efferent duct (data not shown). This expression pattern along the excurrent duct was consistent with the results reported by Kirchhoff (1998). In the vasectomized specimens, the level of HE1 mRNA was greatly reduced all along the epididymis. Very weak or nonexistent hybridization signals were detectable in the epididymal duct epithelium (Figure 1).
To identify the presence of HE1 protein in the epididymides of normal and vasectomized men, immunohistochemistry analysis was carried out using a polyclonal anti-HE1 antibody (Figure 2). As previously described, HE1 protein was detectable in large amounts within the epithelium of the normal human caput, corpus, and cauda epididymides (Kirchhoff et al, 1996). HE1 staining was more intense in the cytoplasm at the apical side of the epithelium. Following vasectomy, the presence of HE1 protein along the epididymis was greatly altered; the staining intensity was tremendously decreased (Figure 2). No reactivity was observed when preimmune serum was used as a negative control (Figure 2G and H).
Expression Patterns of HE2 and HE5 mRNAs and Proteins
The tissue distribution of human HE2 and HE5 mRNAs in the epididymides of normal and vasectomized men was investigated by using a PCR fragment of 359 and 421 bp, respectively (showing 100% identity with HE2 and HE5 cDNAs) (Kirchhoff et al, 1993; Osterhoff et al, 1994), as in situ probes. In contrast to HE1, vasectomy did not affect the distribution or the level of HE2 and HE5 mRNA expression along the human epididymis (Figures 3 and 4). In both normal and vasectomized epididymal tissues, HE2 transcript was expressed in the caput epididymal epithelium. By contrast, HE5 mRNA was predominantly expressed by the epithelial cells of the corpus epididymidis. Both transcripts were predominant in the basal cytoplasm compartment of the principal cells. In all in situ hybridizations performed, no positive signal was observed in the interstitial epididymal tissues. Nor was any signal detected when HE2 or HE5 sense cRNA probes were used as negative controls (Figure 3G and H; Figure 4G and H).
Immunohistologic techniques were used to document the distribution of HE2 and HE5 translational products and the possible effect of vasectomy on their respective localization. As for the transcripts, the protein distribution along the epididymides was not affected by vasectomy. When probed with the anti-P4 peptide antiserum (HE2?1/HE2E-specific), the major peptide isoform in the human epididymis, HE2 was strongly detectable in the cytoplasm of the caput and corpus epididymal epithelium with some labeling in the intraluminal compartment (Figure 5). Similar results were obtained when immunohistologic staining of HE2 was performed using the antiserum raised against the P3 peptide (data not shown). In both intact and vasectomized epididymides, HE5 was uniformly distributed within the cytoplasm of the human epididymal principal cells as described by Kirchhoff et al (1993). The staining signal was more intense in the corpus epididymidis (Figure 6C and D). For both HE2 and HE5 immunodetection, no signal was detectable when preimmune sera or control IgGs were used as negative controls (Figure 5G and H; Figure 6G and H).
Figure 6. Immunohistochemical localization of human epididymal 5 (HE5) in normal (A, C, and E) and vasectomized (B, D, and F) human epididymides. Immunoperoxidase staining of tissue sections was performed employing the anti-HE5 antibody. Red staining shows the presence of HE5 in (A, B) caput, (C, D) corpus, and (E, F) cauda epididymidis. Negative controls: (G) normal corpus region and (H) corpus region under vasectomy incubated with a preimmune serum. Tissues were counterstained in blue with Harris hematoxylin.
In Situ Hybridization and Immunohistochemistry Quantification
Highly reproducible image analysis software was used to quantify HE expression (Doiron et al, 2003). Densitometric quantification of in situ hybridization and immunohistologic staining clearly indicated that, by opposition to HE2 and HE5, only HE1 transcriptional and translational products were affected by vasectomy. When compared to values characterizing normal epididymides, HE1 mRNA and protein were significantly diminished under vasectomy, with P-values <.05 (Figure 7).
Figure 7. Quantification of in situ hybridization (A, C, and E) and immunohistochemistry (B, D, and F) detection of human epididymal 1 (HE1) (A, B), human epididymal 2 (HE2) (C, D), and human epididymal 5 (HE5) (E, F) along the normal and vasectomized human epididymides. Quantification was performed by densitometry expressed as "relative intensity" units (RI). All data are presented as the mean (±SEM). Designations () are significantly different at P < .05.
Discussion
The acquisition of sperm fertilizing ability depends on well-coordinated interactions between the sperm surface and the epididymal intraluminal microenvironment (Cooper, 1998). The composition of the intraluminal fluid is modulated by reabsorption of seminiferous constituents, selective transport of serum molecules, and secretory activity of the epididymal epithelium (Hermo et al, 1994). The protein composition of intraluminal fluid shows great variability along the epididymis, which is a consequence of different patterns of gene expression along the excurrent duct (Dacheux and Dacheux, 2002). The factors that modulate gene expression in different epididymal segments remain to be defined (Cornwall and Hann, 1995; Kirchhoff, 1999; Rodriguez et al, 2001). After vasectomy, the transcription of selected genes appears to be affected in men (Turner et al, 1999; Légaré et al, 2001). Indeed, not all transcripts are affected by vasectomy as demonstrated with HE2 and HE5. However, some transcripts are expressed in another location (P34H) (Légaré et al, 2001), and others almost completely disappear (HE1) (Figure 8). Effects of mRNA expression pattern modifications along the epididymis could affect the maturational process of spermatozoa if the proteins encoded by the affected transcripts are necessary for sperm function or maturational biochemical surface modifications. If these modifications of gene expression pattern persist following vasovasostomy, this could explain the much lower than expected fertility rate with regard to the surgical success of vas reanastomosis.
Figure 8. Relative levels of human epididymal 1 (HE1), human epididymal 2 (HE2), human epididymal 5 (HE5), and the human sperm protein P34H messenger RNAs (mRNAs) along the human epididymis of normal (above the horizontal line) and vasectomized (under the horizontal line) men. P34H mRNA distribution is drawn according to Légaré et al (2001).
Some modifications in mRNA and protein synthesis that occur after vasectomy persist after successful vasovasostomy. In the rat, vasectomy affects the overall pattern of protein synthesis and secretion in the caput epididymidis, including CRISP-1 (Turner et al, 1999). The reduction in CRISP-1 secretion in the caput lumen persists following successful vasovasostomy (Turner et al, 2000). Because it is involved in the mechanism of sperm-egg plasma membrane fusion, CRISP-1 is a critical protein in sperm maturation (Cuasnicu et al, 1999). P34H is a human epididymal protein involved in the acquisition of the ability to interact with the zona pellucida by the maturing spermatozoa (Boué et al, 1994). Whereas the pattern of P34H mRNA expression along the epididymis is altered in vasectomized men, this protein is absent on the spermatozoa of an important percentage of normospermic vasovasostomized men (Guillemette et al, 1999), and the absence of P34H has been associated with male infertility (Boué and Sullivan, 1996; Sullivan, 1999). The amounts of HE1 mRNA and protein are dramatically decreased under vasectomy. Whether or not HE1 levels remain low following vas deferens reanastomosis in vasectomized men is unknown. After ejaculation, HE1 seems to be present in the seminal plasma, but only loosely bound to sperm (Kirchhoff et al, 1996). HE1 sequence shows similarity with a protein purified from ram epididymal fluid (Baker et al, 1993; Okamura et al, 1999) as well as with the NPC2 gene (Ko et al, 2003). These have been shown to function as cholesterol-transfer proteins. Therefore, HE1 may represent a decapacitation factor that regulates the cholesterol content of sperm during maturation, storage, and capacitation (Kirchhoff et al, 1997). In this regard, it would be interesting to compare the cholesterol content of spermatozoa from normal and vasovasostomized men. As for P34H, HE1 could thus be a good indicator of the epididymal sequelae remaining after vasovasostomy in men.
The 3 HE mRNAs and proteins investigated in this study have been selected according to their different expression pattern along the epididymis. HE2 and HE5 were previously reported to be expressed in the proximal and distal regions of the normal human epididymis, respectively (Krull et al, 1993; Kirchhoff, 1999). Our data are in accordance with these reports and show that vasectomy does not affect the level of transcription or the distribution of these epididymal mRNAs. On the other hand, HE1, which shows its maximum expression in the median region of the epididymis, is greatly affected by vasectomy. Like HE1, P34H, which is strongly expressed in the corpus epididymis, is also affected by vasectomy (Légaré et al, 2001). This may suggest that the median region of the epididymis is more "sensitive" to modifications triggered by vasectomy than the proximal caput and distal cauda epididymides. This appears to be the case in cynomolgus monkeys, a species in which vasectomy down-regulates HE2 expression in the corpus region (Doiron et al, 2003). On the other hand, caput epididymidis protein secretion is greatly affected by vasectomy in the rat (Turner et al, 2000). Obviously, epididymal sequelae following vasectomy show species-related differences (Bedford, 1976). Another possibility is that some genes are more responsive to intraluminal changes occurring under vasectomy than others. During vasectomy in man, the height of epididymal epithelium is greatly decreased (Légaré et al, 2001). This is a consequence of the increased intraluminal pressure (Johnson and Howards, 1975) caused by the local accumulation of fluid. Another consequence of fluid accumulation is the modification of lumicrine factor composition of testicular origin (Turner et al, 1999). The consequences for the epithelial functions could be represented by the observed modifications of synthesis and secretion of specific proteins such as HE1 or P34H (Figure 8). The molecular mechanisms responsible for these specific changes remain to be determined. Understanding how vasectomy affects the epididymis will contribute to further comprehension of the control mechanisms of gene expression along the excurrent duct in men.
Acknowledgments
We wish to thank Dr Franck Boué for assistance in tissue preparation, Québec Transplant for their collaboration, and Dr Fabrice Saez for valuable comments and criticisms of the manuscript. We thank Dr Jean-Luc Gatti (UMR6073 INRA-CNRS, Nouzilly, France) for providing the rabbit polyclonal antibody against ram HE1/CTP and Dr Christiane Kirchhoff (University of Hamburg, Germany) for the kind gift of antisera raised against HE2 peptides.
Footnotes
Supported by a Canadian Institutes for Health Research grant (R.S.).
References
Baker C, Magargee S, Hammerstedt R. Cholesterol transfer proteins from ram cauda epididymal and seminal plasma. Biol Reprod. 1993;48(suppl 1):111.
Bedford JM. Adaptations of the male reproductive tract and the fate of spermatozoa following vasectomy in the rabbit, rhesus monkey, hamster and rat. Biol Reprod. 1976; 14:118-142.
Belker AM, Thomas AJ Jr, Fuchs EF, Konnak JW, Sharlip ID. Results of 1,469 microsurgical vasectomy reversals by the Vasovasostomy Study Group. J Urol. 1991;145:505-511.
Boué F, Berube B, De Lamirande E, Gagnon C, Sullivan R. Human sperm-zona pellucida interaction is inhibited by an antiserum against a hamster sperm protein. Biol Reprod. 1994; 51:577-587.
Boué F, Blais J, Sullivan R. Surface localization of P34H, an epididymal protein, during maturation, capacitation, and acrosome reaction of human spermatozoa. Biol Reprod. 1996; 54:1009-1017.
Boué F, Sullivan R. Cases of human infertility are associated with the absence of P34H, an epididymal sperm antigen. Biol Reprod. 1996; 54:1018-1024.
Cooper TG. In defense of a function for the human epididymis. Fertil Steril. 1990; 54:965-975.
Cooper TG. Interactions between epididymal secretions and spermatozoa. J Reprod Fertil. 1998; 53(suppl):119-136.
Cornwall GA, Hann SR. Specialized gene expression in the epididymis. J Androl. 1995; 16:379-383.
Cuasnicu P, Cohen D, Ellerman D. Participation of epididymal protein "DE" and its egg binding sites in sperm-egg fusion. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:267-272.
Dacheux J, Dacheux F. Protein secretion in the epididymis. In: Hinton IBRaB, ed. The Epididymis. New York, NY: Kluwer Academic/Plenum Publishers; 2002:151-168.
Doiron K, Légaré C, Saez F, Sullivan R. Effect of vasectomy on gene expression in the epididymis of cynomolgus monkey. Biol Reprod. 2003; 68:781-788.
Fouchecourt S, Metayer S, Locatelli A, Dacheux F, Dacheux JL. Stallion epididymal fluid proteome: qualitative and quantitative characterization; secretion and dynamic changes of major proteins. Biol Reprod. 2000; 62:1790-1803.
Guillemette C, Thabet M, Dompierre L, Sullivan R. Some vasovasostomized men are characterized by low levels of P34H, an epididymal sperm protein. J Androl. 1999; 20:214-219.
Hamilton DW. Anatomy of mammalian male accessory reproductive organs. In: Lamming G, ed. Marshall's Physiology of Reproduction. Edinburg, United Kingdom: Churchill-Livingstone; 1990 : 691-746.
Hermo L, Oko R, Morales CR. Secretion and endocytosis in the male reproductive tract: a role in sperm maturation. Int Rev Cytol. 1994;154:106-189.
Johnson AL, Howards SS. Intratubular hydrostatic pressure in testis and epididymis before and after vasectomy. Am J Physiol. 1975;228:556-564.
Kirchhoff C. Molecular characterization of epididymal proteins. Rev Reprod. 1998; 3:86-95.
Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188:133-202.
Kirchhoff C, Krull N, Pera I, Ivell R. A major mRNA of the human epididymal principal cells, HE5, encodes the leucocyte differentiation CDw52 antigen peptide backbone. Mol Reprod Dev. 1993; 34:8-15.
Kirchhoff C, Osterhoff C, Young L. Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod. 1996; 54:847-856.
Kirchhoff C, Pera I, Derr P, Yeung CH, Cooper T. The molecular biology of the sperm surface. Post-testicular membrane remodelling. Adv Exp Med Biol. 1997; 424:221-232.
Ko DC, Binkley J, Sidow A, Scott MP. The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels. Proc Natl Acad Sci U S A. 2003; 100:2518-2525.
Krull N, Ivell R, Osterhoff C, Kirchhoff C. Region-specific variation of gene expression in the human epididymis as revealed by in situ hybridization with tissue-specific cDNAs. Mol Reprod Dev. 1993;34:16-24.
Légaré C, Gaudreault C, St-Jacques S, Sullivan R. P34H sperm protein is preferentially expressed by the human corpus epididymidis. Endocrinology. 1999; 140:3318-3327.
Légaré C, Thabet M, Picard S, Sullivan R. Effect of vasectomy on P34H messenger ribonucleic acid expression along the human excurrent duct: a reflection on the function of the human epididymis. Biol Reprod. 2001; 64:720-727.
McDonald SW. Vasectomy review: sequelae in the human epididymis and ductus deferens. Clin Anat. 1996; 9:337-342.
McDonald SW. Cellular responses to vasectomy. Int Rev Cytol. 2000;199:295-339.
Nieschlag A, Behre H, Engelmann U, Hertle L. Male contribution to contraception. In: Nieschlag E, Behre HM, eds. Male Reproductive Health and Dysfunction. Berlin: Springer; 1997:377-393.
Okamura N, Kiuchi S, Tamba M, et al. A porcine homolog of the major secretory protein of human epididymis, HE1, specifically binds cholesterol. Biochim Biophys Acta. 1999; 1438:377-387.
Osterhoff C, Kirchhoff C, Krull N, Ivell R. Molecular cloning and characterization of a novel human sperm antigen (HE2) specifically expressed in the proximal epididymis. Biol Reprod. 1994; 50:516-525.
Robaire B, Hermo L. Efferent ducts, epididymis and vas deferens: structure, functions and their regulation. In: Knobil E, O'Neill J, eds. The Physiology of Reproduction. 1st ed. New York, NY: Raven Press; 1988: 999-1080.
Rodriguez CM, Kirby JL, Hinton BT. Regulation of gene transcription in the epididymis. Reproduction. 2001; 122:41-48.
Schoysman RJ, Bedford JM. The role of the human epididymis in sperm maturation and sperm storage as reflected in the consequences of epididymovasostomy. Fertil Steril. 1986; 46:293-299.
Sharlip ID. What is the best pregnancy rate that may be expected from vasectomy reversal? J Urol. 1993; 149:1469-1471.
Silber SJ. Pregnancy after vasovasostomy for vasectomy reversal: a study of factors affecting long-term return of fertility in 282 patients followed for 10 years. Hum Reprod. 1989; 4:318-322.
Sullivan R. Interaction between sperm and epididymal secretory proteins. In: Gagnon C, ed. The Male Gamete: From Basic to Clinical Applications. Vienna, Ill: Cache River Press; 1999:93-104.
Turner TT. On the epididymis and its role in the development of the fertile ejaculate. J Androl. 1995; 16:292-298.
Turner TT, Riley TA, Mruk DD, Cheng CY. Obstruction of the vas deferens alters protein secretion by the rat caput epididymidal epithelium in vivo. J Androl. 1999; 20:289-297.
Turner TT, Riley TA, Vagnetti M, Flickinger CJ, Caldwell JA, Hunt DF. Postvasectomy alterations in protein synthesis and secretion in the rat caput epididymidis are not repaired after vasovasostomy. J Androl. 2000;21:276-290.
von Horsten HH, Derr P, Kirchhoff C. Novel antimicrobial peptide of human epididymal duct origin. Biol Reprod. 2002; 67:804-813.
Weiske WH. Vasectomy. Andrologia. 2001; 33:125-134.(CHRISTINE LéGARé, NANCY V)