当前位置: 首页 > 医学版 > 期刊论文 > 基础医学 > 病菌学杂志 > 2005年 > 第3期 > 正文
编号:11201726
Involvement of Clathrin-Mediated Endocytosis in Hu
http://www.100md.com 病菌学杂志 2005年第3期
     Abteilung Virologie, Universit?tsklinikum Heidelberg, D-69120 Heidelberg, Germany

    ABSTRACT

    Productive entry of human immunodeficiency virus (HIV) is believed to occur by direct fusion at the plasma membrane. Endocytic uptake of HIV particles has been observed in several studies but is considered to be nonproductive, leading to virus degradation in the lysosome. We show here that endocytosis contributes significantly to productive HIV entry in HeLa cells by using trans dominant-negative mutants of dynamin and Eps15. Inducible expression of a dominant-negative mutant of dynamin in a CD4-positive HeLa cell line reduced HIV infection by 40 to 80%. This effect was independent of the infectious dose and was observed for three different isolates. Analysis of reverse transcription products by real-time PCR and of virus entry by delivery of a virion-associated Vpr-?-lactamase fusion protein revealed a similar reduction, indicating that the block occurred at the entry stage. A strong reduction of HIV entry was also observed upon transient transfection of a different trans dominant-negative variant of dynamin, and this reduction correlated with the relative inhibition of transferrin endocytosis. Expression of a dominant-negative variant of Eps15, which is specific for clathrin-dependent endocytosis, reduced HIV entry in HeLa cells by ca 95%, confirming the role of endocytosis for productive infection. In contrast, no effect was observed for a dominant-negative variant of caveolin. We conclude that dynamin-dependent, clathrin-mediated endocytosis can lead to productive entry of HIV in HeLa cells, suggesting this pathway as an alternative route of virus entry.

    INTRODUCTION

    The first, essential step for a mammalian virus to initiate a successful infection is to overcome the membrane barrier of the host cell, which separates it from the reproduction machinery located in the cytosol or nucleus. Enveloped viruses release their genome into the cytoplasm by fusing the viral envelope with the host membrane, which is initiated by interaction of viral fusion proteins with cellular receptors. Some viruses, such as influenza virus (44, 56) and vesicular stomatitis virus (VSV) (36), need an acidified environment to activate their fusion proteins, and these pH-dependent viruses require internalization by endocytic vesicles to reach the cytosol. Other viruses, such as herpesviruses, are not dependent on low-pH activation and enter the cytosol directly by fusion at the plasma membrane (30), at least in certain cell lines (41). A third mode of entry was recently defined for simian virus 40 (SV40) that is internalized via caveolar vesicles without passing an acidified environment (48, 49).

    Until recently, entry of retroviruses was believed to occur exclusively at the plasma membrane in a pH-independent manner. This was largely based on experiments with inhibitors of endosomal acidification showing no effect on retroviral infection (2, 17, 35, 58). However, inhibitory effects of agents interfering with endosomal acidification may be transient, and the outcome of such experiments can be influenced by the stability of the viral particle. Indeed, entry of avian leukosis virus was subsequently shown to require endosomal entry and acidification after receptor engagement, which had not been detected previously because of high particle stability (39). Recently, endocytosis was also suggested to be important for cytosolic entry of amphotropic and ecotropic murine leukemia viruses (27).

    Since lysosomotropic agents did not decrease infection, productive entry of human immunodeficiency virus type 1 (HIV-1) is believed not to require acidification and has generally been assumed to take place at the plasma membrane (37, 58). However, nonspecific vesicular internalization of HIV-1 particles can be readily observed in cells independently of expression of the primary entry receptor CD4. Despite internalization of virions, productive infection of CD4-negative cells was not detected by cell fractionation (33) and electron microscopic studies (23, 24). Furthermore, the presence of CD4 and a coreceptor at the cell surface has been shown to be a prerequisite for cytoplasmic entry of HIV-1 (18, 51), and HIV-1 readily infects cells expressing internalization-deficient mutants of CD4 or CCR5 (7, 46). Endocytic uptake of HIV-1, which is frequently observed, is therefore generally judged as a dead end for productive infection.

    Although most particles internalized by the vesicular pathway appear to be degraded in the lysosome, there is no direct evidence that escape from vesicles into the cytosol via receptor-mediated fusion does not occur. The gradual pH decrease in the lumen of endocytotic vesicles may permit escape to the cytoplasm for at least some HIV-1 particles prior to damage of the particle by strong acidification. Recent studies demonstrated that endocytic entry by HIV-1 can indeed be productive depending on the experimental conditions, target cells, and viral isolates used (19, 21, 34, 52). For example, inhibition of acidification has been shown to enhance HIV-1 infectivity, presumably by blocking endosomal or lysosomal degradation (21). Moreover, HIV-1 particles were detected in macropinosomes upon infection of macrophages and in this cell type vesicular uptake and access to the cytosol were inhibited by dimethyl amiloride, an inhibitor of macropinocytosis (34).

    Distinct cellular structures such as caveolae, clathrin-coated pits, macropinosomes, and phagosomes are utilized by different viruses for endocytic entry (reviewed in reference 47). The cellular GTPase dynamin is essential for clathrin-mediated and caveolar transport (26, 43, 54), whereas fluid-phase uptake is not inhibited by dynamin mutants (14, 15). Mutant dynamin molecules have been useful for the study of entry pathways of different viruses and for the characterization of the endocytic route (48, 49, 57). Dynamin is a 100-kDa GTPase that mediates the release of dynamin-dependent endocytic vesicles from the plasma membrane. trans dominant-negative dynamin mutants contain point mutations that affect either their ability to hydrolyze GTP in a temperature-dependent manner (dynG273D or dynts) or their affinity for GTP (dynK44A). Both dynamin variants prevent the pinching off of endocytic vesicles from the inner leaflet of the plasma membrane. Dynamin might also play a role in phagocytosis (22), whereas its function in macropinosomal transport is controversial and may depend on experimental conditions (38, 53). Dominant-negative dynamin interferes with several endocytic routes and specific inhibition of either clathrin-mediated endocytosis or caveolar uptake can be achieved by other trans dominant-negative proteins exclusively affecting one of these pathways. A dominant-negative variant of Eps15, an interaction partner of the AP2 complex, inhibited clathrin-mediated endocytosis specifically and blocked Sindbis virus, Semliki Forest virus, and adenovirus infection (reviewed in reference 55). A green fluorescent protein (GFP)-caveolin fusion protein, on the other hand, selectively interfered with SV40 uptake by caveolae (48, 49).

    We characterized here the role of endocytic processes for productive entry of HIV-1 by using trans dominant-negative mutants of dynamin, Eps15, and caveolin to block endocytosis without interfering with the endosomal pH. Expression of dynts in a stably transduced HeLa cell line during the entry phase reduced the number of infected cells, the accumulation of reverse transcription (RT) products, and the cytosolic entry of HIV-1 by 40 to 80%. These effects were observed over a wide range of infectious doses and for various HIV-1 isolates. Cytosolic entry was also strongly inhibited by dynK44A and dominant-negative Eps15. In contrast, dominant-negative caveolin-1 did not interfere with HIV-1 entry. We conclude that dynamin-dependent, clathrin-mediated uptake can lead to productive entry by HIV-1, suggesting this pathway as an alternative route of virus entry to fusion at the plasma membrane.

    MATERIALS AND METHODS

    Plasmids. Plasmids Eps15GFP (originally named DIII2) and dnEps15GFP (originally named E95/295) have been described previously (3, 4) and were provided by A. Dautry-Varsat. The caveolin-1 expression plasmid cavGFP (originally named caveolin1-GFP) has been described (48). Plasmid dncavGFP (originally named pINDEGFPVIP) has also been described (32). Mutant dynaminK44A was described by van der Bliek et al. (60). DynwtGFP (originally named Dyn2-GFP) was described previously (8). CavGFP, dncavGFP, dynwtGFP, and dynK44AGFP were provided by A. Helenius. The expression vector for the fusion protein of ?-lactamase and Vpr (pMM310) (59) was a gift from N. Landau. The expression plasmid for the envelope glycoprotein of VSV (VSV-G) under control of the cytomegalovirus promoter (pM3) was provided by D. von Laer. An HIV-1 proviral clone with a deletion of the env open reading frame (pNL4-3env–GFP) was provided by D. Gabuzda (25).

    Cells and tissue culture. HeLa cells, CD4-positive HeLaP4 cells (10), and 293T cells were grown in Dulbecco modified Eagle medium (Gibco) supplemented with 10% heat-inactivated fetal calf serum (FCS), penicillin (100 U/ml), streptomycin (100 μg/ml), and 4 mM glutamine. MT-4 cells were maintained in RPMI 1640 medium supplemented with 10% FCS, penicillin (100 U/ml), streptomycin (100 μg/ml), 4 mM glutamine, and 5 mM HEPES-free acid. All cells were cultivated at 37°C and 5% CO2.

    The stably transformed tTA-HeLa cells with tightly regulated expression of dynts were kindly provided by S. Schmid (13). This cell line expresses a dynamin variant with a point mutation from G to D in position 273 under control of a tetracycline-regulated promoter. The G273D mutation was first discovered in the Drosophila mutant shibire, which fails to recycle neurotransmitters at the synapse at the nonpermissive temperature (28). The packaging cell line PA317/CD4 releasing amphotropic retrovirus vector particles transducing the human CD4 gene has been described (11) and was provided by P. Clapham. To produce a CD4-positive derivative of dynts cells, retrovirus vector particles were harvested from PA317/CD4 cells, filtered, and used to transduce the stably transformed tTA HeLa cells with regulated dynts expression in the presence of 8 μl of Polybrene/ml. Cells were cultured in Dulbecco modified Eagle medium with the described supplements and 200 ng of puromycin (Sigma)/ml, 400 μg of Geneticin (Gibco)/ml, 1 μg of tetracycline (tet) (Sigma)/ml, and 1 mM sodium pyruvate. Transduced cells were incubated with CD4 antibodies conjugated to superparamagnetic MicroBeads (Miltenyi Biotec) and CD4-positive cells were preselected by magnetic activated cell sorting. Clonal cell lines were selected by staining with an antibody against CD4 conjugated with fluorescein isothiocyanate (FITC) and sorting of single CD4-positive cells by using a FACSsorter. Cell lines were analyzed for expression of CD4 and tet-inducible expression of dynts by fluorescence-activated cell sorting (FACS) and immunofluorescence, respectively, resulting in the cell line HeLa4D9.

    For single-round entry assays, 3 x 105 HeLa4D9 cells in 10-cm plates were incubated overnight in medium supplemented with 1 μg of tet/ml at 37°C, followed by incubation in the presence or absence of tet for 24 h at 32°C. Subsequently, cells were treated with trypsin and plated according to the type of the experiment (1.1 x 104 cells per 48 wells for analysis of viral capsid [CA] expression by immunostaining, 2.5 x 104 cells per 24 wells for real-time PCR, and 1.5 x 105 cells per 6-cm plate for analysis of HIV-1 infection by fluorescence-activated cell sorting [FACS], for Blam assay, and to control uptake of transferrin) in the absence or presence of tet, respectively. After 48 h at 32°C, cells were incubated at 37°C for 1.5 to 2 h to establish the endocytosis-deficient phenotype or kept at 30°C. Virus was prewarmed to 37°C and added at the indicated multiplicity of infection (MOI). To avoid influences by tet on infection, cells were not exposed to tet during virus incubation. To control the efficiency of endocytosis inhibition, parallel cultures on coverslips were analyzed for transferrin uptake.

    Virus production and titration. Stocks of HIV-1NL4-3, HIV-1SF2, and HIV-1MVP8161 were produced by cocultivation of infected and uninfected MT-4 cells (61). Uninfected cells (5 x 105 cells/ml) were mixed with infected cells at a ratio of 5:1 and virus was harvested before pronounced cytopathic effects were observed (24 to 36 h postinfection). Virus-containing supernatants were cleared by low-speed centrifugation, filtered through 0.45-μm-pore-size filters (Schleicher & Schuell), and adjusted to 10 mM HEPES (pH 7.4). Aliquots were frozen at –80°C or in liquid nitrogen.

    HIV-1 particles carrying the ?-lactamase (Blam)-Vpr fusion protein were produced by cotransfection of 293T cells with the HIV-1 proviral plasmid pNLC-43 (6) and pMM310. HIV-1 particles pseudotyped with the VSV-G glycoprotein were produced by cotransfection of 293T cells with pNL4-3env–GFP and pM3. Transfections were performed by using Lipofectamine 2000 (Invitrogen) according to the description of the manufacturer. After 48 h at 37°C, virus-containing culture media were harvested, cleared as described above, and concentrated 10-fold by centrifugation through an Amicon Ultra filter (30-kDa exclusion limit).

    Virus titrations were performed in quadruplicate by using serial 10-fold dilutions of the respective virus. After incubation for 2 days at 37°C, HIV-1-infected cells were detected by staining with a monoclonal antibody to the CA protein and a secondary antibody conjugated with ?-galactosidase (BIOZOL) as described previously (12).

    Immunofluorescence and FACS analysis. The expression of dynts was detected by using a FITC-conjugated monoclonal antibody to the epitope tag from influenza virus hemagglutinin (HA; Roche). Cells were fixed in 3.7% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, followed by incubation in 50 mM ammonium chloride for 15 min and immunostaining. To analyze the inhibition of clathrin-dependent endocytosis by dominant-negative dynamin, cells were incubated with Alexa Fluor 568-labeled transferrin (Molecular Probes) 20 min prior to fixation as described above. Fluorescence was visualized on an IX70 epifluorescence microscope (Olympus), and images were captured and processed with Soft Imaging System and Adobe Photoshop.

    For FACS analysis of HIV receptor expression, cells were fixed (Fix & Perm kit; Becton Dickinson), incubated with FITC-conjugated antibodies to CD4 and phycoerythrin (PE)-conjugated antibodies against CXCR4 (Becton Dickinson), respectively, and analyzed by using a FACScan (Becton Dickinson). FACS analysis of HIV-1-infected HeLa4D9 cells was performed 48 h after infection. Cells were fixed for 1 h at room temperature in 3.7% paraformaldehyde in PBS and stained for 30 min at room temperature in the dark with a monoclonal antibody to CA conjugated with PE (KC57-RD1; Coulter) diluted 1:20 in 0.1% Triton X-100 in PBS containing 3% FCS.

    Detection of virus entry using the ?-lactamase assay. Cytosolic entry of HIV-1 particles carrying the Blam-Vpr fusion protein was analyzed as described previously (59). HeLa4D9 cells or transfected HeLa cells grown on coverslips were infected with HIV-1NL4-3 particles carrying the Blam-Vpr protein at the indicated MOI for 5 h. Fluorescently labeled transferrin (Molecular Probes) was added to transfected HeLa cells 20 min prior to washing. Cells were washed with CO2-independent medium (Invitrogen) and loaded with the fluorescent Blam substrate CCF2/AM as described by the manufacturer (Pan Vera). Cells were incubated for 17 h at room temperature to allow cleavage of the substrate and subsequently washed and fixed with 3.7% paraformaldehyde in PBS. The relative number of cells fluorescent at 447 nm among GFP-expressing (detected after short bleaching of the uncleaved substrate at 520 nm) and GFP-negative cells was determined by microscopic analysis of at least 400 cells each.

    Quantitation of RT products. To remove DNA from the virus preparation, HIV-1 particles were treated with 300 U of DNase (Roche)/ml for 30 min at 37°C. Cells were infected with DNase-treated virus and total DNA was isolated at different time points by using a QIAamp Blood Minikit (Qiagen) or DNAzol (Invitrogen) according to the recommendations of the manufacturers. Quantification of RT products from the U3 region was performed by real-time PCR in the LightCycler (Roche) with the primers 48U3 (sense, TGGATCTACCACACACAAGGCTA) and 118U3 (antisense, AGCACCATCCAAAGGTCAGTG). Three independent analyses were performed for each sample, and serial dilutions of a pNL4-3 derivative in unspecific genomic DNA were used as a standard. For normalization, total DNA amounts of each sample were measured by photometry at 260 nm or the cellular single-copy gene encoding gapdh was quantified in parallel by real-time PCR.

    RESULTS

    Establishment of an HIV-infectible HeLa cell line expressing a dominant-negative variant of dynamin. To investigate the role of the endocytic pathway in the entry of HIV-1, we transduced a HeLa cell line containing a tightly regulated variant of dynamin (15) with a retrovirus vector carrying the human CD4 gene. The parental cells express a trans dominant-negative, temperature-sensitive mutant of dynamin (G273D; dynts) (29) under control of a tetracycline-responsive promoter. In the absence of tet, expression of the dynamin mutant is induced, and efficient inhibition of clathrin-dependent endocytosis is observed at the nonpermissive temperature of 37 or 38°C (15). No inhibition occurs at the permissive temperature of 30°C. To score for inhibition, dynts is first produced at the permissive temperature (30 to 32°C), allowing oligomerization with endogenous dynamin, and the temperature is then shifted to 37°C to induce the trans-dominant phenotype.

    CD4-positive cells were initially isolated by magnetic separation of transduced cell populations and were shown to retain inducible expression of dynts (data not shown). To establish a clonal cell line, single CD4-positive cells were isolated by FACS. Individual cell clones were analyzed for stable CD4 expression (Fig. 1B) and for inducible expression of dynts, and the cell line HeLa4D9 was selected for further experiments. To test the inducible inhibition of clathrin-dependent endocytosis, HeLa4D9 cells were cultivated in the presence or absence of tet at 32°C for 3 days. Subsequently, cells were either shifted to the nonpermissive temperature for 1.5 h or were incubated for 1 h at 30°C after the 37°C shift. Twenty minutes before fixation, fluorescently labeled transferrin was added to monitor clathrin-mediated internalization. Expression of dynts was analyzed with an antibody directed against the HA epitope tag on dynts. No HA signal was detected when cells were repressed by cultivation in the presence of tet (Fig. 1Ac), and normal transferrin endocytosis was observed as indicated by the punctate staining in the perinuclear region (Fig. 1Ac'). Cultivation for 3 days in the absence of tet, on the other hand, yielded a strong signal for dynts in HeLa4D9 cells, which was mainly observed in membrane ruffles and lamellipodia (Fig. 1Aa and b). When cells were kept at the permissive temperature, the uptake of fluorescently labeled transferrin was largely unaltered (Fig. 1Ab'), whereas clathrin-mediated endocytosis of transferrin was efficiently blocked after incubation at the nonpermissive temperature (Fig. 1Aa'). Weak staining at the plasma membrane, but no intracellular punctate staining, was observed in 80 to 95% of HeLa4D9 cells cultivated at 37°C. Thus, this cell line retains the inducible inhibition of clathrin-dependent endocytosis.

    To determine whether inhibition of endocytosis interferes with the cell surface expression of the HIV-1 entry receptors, flow cytometric analyses were performed (Fig. 1B). Expression of dynts was induced or suppressed in HeLa4D9 cells as described above, and cells cultivated for an additional 1.5 or 5 h at either 30 or 37°C were fixed and stained with antibodies against CD4 or CXCR4, respectively. As shown in Fig. 1B (left panel), there was no difference in CD4 surface expression and >98% of the cells were CD4 positive in every case, with a similar mean fluorescence intensity. The same result was observed for the HIV-1 coreceptor CXCR4 (Fig. 1B, right panel). CD4 and CXCR4 surface expression were also unchanged after incubation for 5 h at 37°C (data not shown). Thus, HeLa4D9 cells represent a CD4-positive HeLa cell line that is suitable for the investigation of the influence of endocytosis on HIV-1 entry.

    Dominant-negative dynamin leads to a strong reduction of HIV-1 infection in HeLa4D9 cells. To examine the influence of dynamin-dependent endocytosis on HIV-1 entry in a single-round infection assay, the following experimental protocol was established (Fig. 2A). The expression of dynts was induced or suppressed in HeLa4D9 cells as described above, and cells were cultivated for an additional 1.5 h at 37°C to induce the dominant-negative phenotype. The effect of dynts was confirmed by analyzing the internalization of transferrin in parallel samples (data not shown). Subsequently, HIV-1 particles were added at different MOIs, and incubation was continued for a further 5 to 7 h at 37°C. Medium was replaced, and tet was added to repress expression of dynts. The half time of dynts at 37°C was shown to be about 8 h, and no inhibition of endocytosis was observed 20 h after the readdition of tet (data not shown). Thus, a potential influence of residual dynts on HIV-1 gene expression and virion formation could be excluded. Upon removal of the virus inoculum, the reverse transcriptase inhibitor azidothymidine was added to avoid subsequent infection by remaining particles. HIV-1 protein expression was detected after incubation for 2 days at 37°C by immunostaining for the HIV-1 CA protein.

    Figure 2B shows the results of representative experiments. All assays were performed in 48 wells in triplicates, and mean values of the total number of infected cells are depicted. Infection of repressed HeLa4D9 cells cultivated in the presence of tet with HIV-1NL4-3 at an MOI of 0.06 yielded a mean number of 224 infected cells per well (Fig. 2B, bar 2). Infection of dynts-ex