Inhibition of Preproinsulin Gene Expression by Leptin Induction of Suppressor of Cytokine Signaling 3 in Pancreatic -Cells
http://www.100md.com
《糖尿病学杂志》
1 Division of Metabolism, Endocrinology and Molecular Medicine, Medizinische Klinik and Poliklinik II, University of We箁zburg, We箁zburg, Germany
2 Laboratory of Molecular and Cellular Medicine, the Departments of Cellular and Physiological Sciences and Surgery, University of British Columbia, Vancouver, British Columbia, Canada
GFP, green fluorescent protein; JAK, janus kinase; PY, anti-phosphotyrosine; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; STATRE, STAT-responsive element
ABSTRACT
Leptin inhibits insulin secretion and preproinsulin gene expression in pancreatic -cells, but signal transduction pathways and molecular mechanisms underlying this effect are poorly characterized. In this study, we analyzed leptin-mediated signal transduction and preproinsulin gene regulation at the molecular level in pancreatic -cells. Leptin stimulation led to janus kinase (JAK)2-dependent phosphorylation and nuclear translocation of the transcription factors signal transducer and activator of transcription (STAT)3 and STAT5b in INS-1 -cells. Leptin also induced mRNA expression of the JAK-STAT inhibitor suppressor of cytokine signaling (SOCS)3 in INS-1 -cells and human pancreatic islets in vitro and in pancreatic islets of ob/ob mice in vivo. Transcriptional activation of the rat SOCS3 promoter by leptin was observed with concomitant leptin-induced STAT3 and STAT5b DNA binding to specific promoter regions. Unexpectedly, SOCS3 inhibited both basal and STAT3/5b-dependent rat preproinsulin 1 gene promoter activity in INS-1 cells. These results suggest that SOCS3 represents a transcriptional inhibitor of preproinsulin gene expression, which is induced by leptin through JAK-STAT3/5b signaling in pancreatic -cells. In conclusion, although SOCS3 is believed to be a negative feedback regulator of JAK-STAT signaling, our findings suggest involvement of SOCS3 in a direct gene regulatory pathway downstream of leptin-activated JAK-STAT signaling in pancreatic -cells.
The hormone leptin is the product of the obese (ob) gene, primarily produced by white adipose tissue (1) and typically circulates in proportion to body fat mass (2). Leptin acts on specific regions in the hypothalamus to inhibit food intake and raise energy expenditure. Elevated leptin levels in obese subjects are believed to be indicative of resistance to leptin. Leptin has also been shown to inhibit insulin secretion and preproinsulin gene expression in pancreatic -cells (3eC6), thereby establishing an adipoinsular feedback loop in concert with stimulatory action of insulin on leptin secretion from the adipose tissue (7,8). Dysregulation of this adipoinsular axis with the establishment of leptin resistance in pancreatic -cells may lead to hyperinsulinemia, which could contribute to obesity and insulin resistance.
Leptin signal transduction occurs through a distinct receptor of the class 1 cytokine superfamily of receptors (9), which is intracellularly coupled to the janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway (10). Several leptin receptor (ObR) isoforms are known, but the majority of physiological effects appear to be mediated via the longest form (ObRb) (11,12). In previous experiments, we and others have demonstrated that ObR isoforms, including ObRb, are expressed and functional in pancreatic -cell lines and primary pancreatic islets (3,13). Binding of leptin to ObRb activates the receptor-associated kinase JAK2 via transphosphorylation and phosphorylates tyrosine residues on ObRb. Subsequently, transcription factors of the STAT family are recruited to the receptor and also phosphorylated. Phosphorylated STATs dimerize and translocate to the nucleus to regulate gene transcription (14). STATs have mainly been shown to transcriptionally enhance gene expression. However, we previously determined that leptin increases binding of STAT5b to the upstream sequences of the rat preproinsulin 1 promoter (6) and inhibits insulin biosynthesis via transcriptional repression (5). In this study, we sought to characterize this apparent contradiction at the molecular level.
Suppressors of cytokine signaling (SOCS) belong to a family of molecules that inhibit cytokine signaling by inhibiting JAK-STAT signal transduction. These molecules contain a central Src-homology 2 domain and a conserved COOH-terminal SOCS box. Through the Src-homology 2 domain, they bind directly to tyrosine-phosphorylated residues on the cytokine receptoreCassociated kinase JAK2, which blocks the access of STATs to receptor binding sites and leads to inactivation of the JAKs (15). Expression of SOCS proteins is induced by various cytokines and hormones, including interleukin-6, leukemia inhibitory factor, erythropoietin, growth hormone, and leptin (16eC18). Accumulating evidence suggests that SOCS3 is a leptin-induced negative feedback regulator of leptin receptor signaling that may be involved in the development of leptin resistance in the hypothalamus (16eC22).
Here, we provide evidence that leptin induces SOCS3 expression in pancreatic -cells by transcriptional mechanisms involving transcription factors of the STAT family. Moreover, we discovered that SOCS3 reduces preproinsulin gene expression in pancreatic -cells that was previously attributed directly to leptin activation of STAT molecules. Thus, we provide a molecular mechanism by which leptin confers inhibitory effects at the level of preproinsulin gene promoter activity, and we thereby extend the function of SOCS3 beyond that of a feedback inhibitor of JAK-STAT signaling.
RESEARCH DESIGN AND METHODS
Cell lines and culture conditions.
The rat insulinoma cell line INS-1 was obtained from Dr. Claes B. Wollheim (University of Geneva, Switzerland) and grown as reported previously (23). Cells were deprived of serum and antibiotics for a 12- to 15-h period before they were stimulated with murine leptin (Recombinant Mouse Leptin; R & D Systems, Minneapolis, MN) at concentrations of 0.625 nmol/l (10 ng/ml) for different time periods.
RNA isolation and RT-PCR for STAT mRNA in pancreatic -cells.
Total RNA from the INS-1 rat pancreatic -cell line was extracted using TRIZOL reagent (Invitrogen Life Technologies, Gaithersburg, MD) and subjected to DNase I digest. Digested RNA was reverse transcribed by oligo-dT priming with reverse transcriptase (Superscript; Invitrogen Life Technologies). After reverse transcription, the cDNA was subjected to PCR amplification for STAT1, -2, -3, -4, -5a, -5b, and -6 using sequence-specific oligonucleotides (STAT1: sense, 5'-TGAACTCCATCGAGCTCACTCAGAACACT-3', and antisense, 5'-AGAGGACGAAGGTGCGATCGGATAAC-3' [264-bp PCR product; GenBank accession number AF053767]; STAT2: sense, 5'-GAAGGGGGCATTACTTGTTCTTGGGTGGAG-3', and antisense, 5'-GCGGATGATCTCTGCCAGTGGGAGTGAC-3' [140-bp PCR product; GenBank accession number BC064827]; STAT3: sense, 5'-TGGAAGAGGCGGCAGCAGATAGC-3', and antisense, 5'-GCACGGCCCCCATTCCCACAT-3' [545-bp PCR product; GenBank accession number X91810]; STAT4: sense, 5'-AAACTATGGCAACAATTCTCCTTCAAAAC-3', and antisense, 5'-GCCGCAGCCAGTATTCTCCTCTC-3' [208-bp PCR product; GenBank accession number AF055291]; STAT5a: sense, 5'-GCAACATTTCCCCATCGAGGTCCGGCACTACC-3', and antisense, 5'-GTGGCCTGGCCTCGGTCCTGGGGATTG-3' [105-bp PCR product; GenBank accession number U24175]; STAT5b: sense, 5'-GCCAGCATTTCCCCATCGAGGTGCGACATTATTTA-3', and antisense, 5'-GTCATACGTGTTCTGGAGCTGCGTGGCATAGTGC-3' [230-bp PCR product; GenBank accession number X97541]; STAT6: sense, 5'-CCAGCCGGGGACTGCTACCAGAACACTTC-3', and antisense, 5'-CCGGATGACATGGGCAATGGTGATGC-3' [341-bp PCR product; GenBank accession number AF055292]) according to the following conditions: 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C (36 cycles). Identity of the PCR products was confirmed by sequencing (data not shown).
Immunoprecipitation and Western blotting.
After stimulation of INS-1 cells with leptin (10 ng/ml) at 30 min, 3 h, and 6 h, whole-cell extracts were prepared in ELB buffer (100 mmol/l NaCl, 0.1% NP-40, 50 mmol/l Hepes, 1 mmol/l phenylmethylsulfonyl fluoride, 5 mmol/l EDTA, and 0.5 mmol/l dithiothreitol). Equal amounts of protein were immunoprecipitated at 4°C with antisera specific for JAK2, STAT3, or STAT5b (Santa Cruz Biotechnology, Santa Cruz, CA) overnight followed by incubation with protein A-Sepharose for 1 h. Immunoprecipitated proteins were separated by a 12% SDS polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were probed with a mouse monoclonal anti-phosphotyrosine antibody (clone 4G10; Upstate Biotechnology, Lake Placid, NY) or antisera specific for STAT3 or STAT5b, respectively.
Immunocytochemistry and green fluorescent protein studies.
INS-1 cells were grown on coverslips, serum deprived overnight, stimulated with leptin (10 ng/ml) for different time periods, fixed with 4% paraformaldehyde, and permeabilized with eC20°C methanol. Slides were then incubated with STAT3 or STAT5b rabbit antisera (Santa Cruz Biotechnology) for 1eC2 h at room temperature and then incubated with a fluorescent secondary antiserum coupled to indocarbocyanide. Microscopic imaging was performed on a Zeiss epifluorescent microscope coupled to an Optronics TEC-470 CCD camera interfaced with digital imaging analysis software (IP-Lab Spectrum; Signal Analytics, Vienna, VA) on a power Macintosh computer.
For green fluorescent protein (GFP) studies, INS-1 cells were stably transfected (Transfast; Promega, Mannheim, Germany) with a cDNA encoding a GFP-Stat5b fusion protein (provided by Dr. Carter-Su, Baylor College of Medicine, Houston, TX) (24). Cells were incubated at 37°C in serum-free media for 30 min before incubation with vehicle or murine leptin (10 ng/ml; PeproTech, Rocky Hill, NJ) for 15 min. Imaging was performed by exciting GFP at 488 nm using a Leica DMIRB microscope. For every dish, 20 cells were imaged. For quantitative analysis of fluorescence distribution, images were captured via a CoolSnap camera (RS Photometrics, Tucson, AZ), and intensity values of neighboring nuclear and cytosolic regions were calculated using IP-Lab software. The nuclear-to-cytosol ratio of fluorescence was calculated in images captured from four separate experiments. Statistical significance was determined by ANOVA analysis.
Expression of SOCS3 mRNA in INS-1 cells, human pancreatic islets, and pancreatic islets of ob/ob mice.
mRNA was extracted from rat INS-1 pancreatic -cells after incubation with 10 ng/ml murine leptin (Recombinant Mouse Leptin; R & D Systems) for the indicated time periods. Human pancreatic islet cDNA was reverse transcribed from mRNA that was extracted from human islets after incubation with 10 ng/ml human leptin (PeproTech) or vehicle for the indicated time period during an earlier study (5). Ob/ob mice (n = 4 per time point) were injected intraperitoneally in vivo with murine leptin (Recombinant Mouse Leptin; R & D Systems) at 1 e蘥/g body wt or vehicle, and pancreatic islets were isolated at different time points after intraperitoneal injection for mRNA extraction as previously described (6). Semiquantitative RT-PCR for rat, human, and mouse SOCS3 mRNA and -actin were performed as described previously (5,25). The primers used for amplification of rat SOCS3 were sense, 5'-GCTCCGTGCGCCATGGTCACCCACAG-3', and antisense, 5'-CTTTGCTCTTTAAAGTGGAGCATCATACTG-3'; 699-bp PCR product (GenBank accession number AJ249240). Primer oligonucleotides used for amplification of human SOCS3 were sense, 5'-CGCCACTTCTTCACGCTCAG-3', and antisense, 5'-AGGGGCCGGCTCAACACC-3'; 317-bp PCR product (GenBank accession number AF159854). The primer oligonucleotides for murine SOCS3 were sense, 5'-GACACCAGCCTGCGCCTCAAGAC-3', and antisense, 5'-CCGGAACTTCGGACGAGGGTTCC-3'; 397-bp PCR product (GenBank accession number AF314501). PCR conditions were 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 57°C (30 s at 60°C for human SOCS3), and 30 s at 72°C (18 cycles, 22 cycles for human SOCS3). All results are derived from at least three independent experiments.
Nuclear extracts and electrophoretic mobility shift assay.
INS-1 cells were serum deprived overnight before stimulation with 10 ng/ml leptin. Nuclear extracts were prepared as described previously (26). In vitroeCtranslated STAT5b was obtained from the plasmid STAT5bpcDNA3.1- using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer’s protocol. Ten micrograms nuclear extract or 5 e蘬 TNT in vitro translation reaction were added to 5x electrophoretic mobility shift assay buffer (100 mmol/l KPO4, pH 7.9, 5 mmol/l EDTA, 5 mmol/l dithiothreitol, and 20% glycerol), 50 mmol/l KCl, 1 e蘥 poly-dIdC, and 40,000 cpm/e蘬 32P-labeled double-stranded oligonucleotide. DNA probes were generated by annealing two oligonucleotides, followed by a fill-in reaction with Klenow polymerase and dGTP, dCTP, dTTP, and [-32P]dATP. The oligonucleotide sequence corresponding to a sequence from eC363 to eC332 bp of the rat SOCS3 promoter, containing a eC351- to eC344-bp putative STAT binding site, named A-STAT, was 5'-363AGAAACCAGCCTTCTTAGAAGGGAGGGGGTGGeC332-3'. The oligonucleotide sequence corresponding to a sequence from eC107 to eC75 bp of the rat SOCS3 promoter, containing a eC95- to eC87-bp putative STAT binding site, named B-STAT, was 5'-eC107AGTGACTAAACATTACAAGAAGACCGGCCGCGCeC75-3'. The oligonucleotide sequence corresponding to a sequence from eC82 to eC52 bp of the rat SOCS3 promoter, containing a eC72- to eC64-bp putative STAT binding site, named C-STAT, was: 5'-eC83CGGCCGCGCAGTTCCAGGAATCGGGGGGGCGGeC52-3' (GenBank accession number AJ249240). After incubation on ice for 15 min, the samples were loaded onto a 5% polyacrylamide gel and run in 0.5x Tris-borate-EDTA buffer for 2 h. For supershift assays, 4 e蘬 of STAT1, STAT3, or STAT5b antisera (Santa Cruz Biotechnology) was added before samples were loaded onto the gel.
Plasmids, transient DNA transfection, and luciferase assays.
The plasmid eC1054rSOCS3pGL3 contains a fragment of the rat SOCS3 promoter between base pairs eC1,054 and 222. It was generated by PCR from rat genomic DNA and cloned into the luciferase reporter vector pGL3 (Promega). The plasmid eC410rINS-1 contains 410 bp of the promoter region of the rat preproinsulin 1 gene also cloned into the luciferase reporter vector pGL3 (Promega) (27). The rSOCS3pcDNA3.1- expression plasmid contains the full-length coding sequence of rat SOCS3. Identity of all vectors has been confirmed by sequencing. Rat STAT5b pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX).
INS-1 -cells were transfected using Lipofectamine (Invitrogen Life Technologies) and 2 e蘥 eC1054rSOCS3pGL3 vector in duplicate samples in serum-free medium and incubated with 10 ng/ml leptin or vehicle. For cotransfection experiments, INS-1 -cells were cotransfected with 2 e蘥 eC410rINS-1pGL3 vector and 1,000 ng rSTAT5bpcDNA3.1- and rSOCS3pcDNA3.1- in duplicates. Luciferase expression was measured after 12 h as described previously (28). Data shown in each figure are mean values ± SE of at least six independent experiments and are normalized to protein concentrations.
RESULTS
Expression of STAT isoforms in pancreatic -cells.
We found abundant mRNA expression for the isoforms STAT1 as well as STAT3, STAT5b, and STAT6 in this insulin-producing pancreatic -cell line (Fig. 1), whereas mRNA expression for the isoforms STAT2, STAT4, and STAT5a was not detectable. These results indicate that constituents of the JAK-STAT signaling pathway that have been shown to be involved in leptin signaling in other tissues (10,29) are expressed in the INS-1 -cell line.
Leptin induces phosphorylation of STAT3 and STAT5b through receptor-associated JAK2 in INS-1 -cells.
To test whether the JAK-STAT signaling pathway is activated by leptin in insulin-producing cells, immunoprecipitation experiments were performed in leptin-treated INS-1 cells. As shown in Fig. 2A, leptin treatment of serum-deprived INS-1 -cells induces tyrosine phosphorylation of leptin receptoreCassociated JAK2 in a time-dependent manner while the total amount of precipitated JAK2 protein remained constant (Fig. 2A, bottom panel). When JAK2 immunoprecipitates from leptin-treated INS-1 cells were immunoblotted with antisera specific for STAT3 (Fig. 2B, top panel) and STAT5b (Fig. 2C, upper panel), recruitment and association of STAT3 and STAT5b to JAK2 was observed as early as 30 min after leptin stimulation. Subsequent to the recruitment of STAT3 and STAT5b to JAK2, time-dependent tyrosine phosphorylation of these transcription factors was observed (Figs. 2B and C, middle panels). Immunoblotting of STAT3 and STAT5b immunoprecipitates from leptin-treated INS-1 cells with either STAT3-specific (Fig. 2B, bottom panel) or STAT5b-specific (Fig. 2C, bottom panel) antisera revealed equal total amount of STAT precipitates throughout the time course of the experiments. These results indicate that STAT3 and STAT5b coimmunoprecipitate with JAK2 in a phosphorylation-dependent fashion after leptin stimulation and suggest phosphotyrosine-mediated protein interaction of JAK2 and STAT3 and STAT5b in leptin-treated -cells. Co-immunoprecipitation of the other isoforms of STAT molecules (STAT1 and STAT6), which are also expressed in INS-1 cells (Fig. 1), with JAK2 was not detected (data not shown).
Leptin induces nuclear translocation of STAT3 and STAT5b in INS-1 -cells.
As shown in Fig. 3A, we find STAT3 (Fig. 3A, top panel) as well as STAT5b (Fig. 3A, bottom panel) molecules in the nucleus as early as 30 min after leptin treatment in the majority of cells. Nuclear predominance of STAT molecule localization continued up to 3 h after a single leptin application, whereas after 6 h, subcellular localization was predominantly cytoplasmic again in the majority of cells. In INS-1 cells stably overexpressing a GFP-STAT5b fusion protein, significant nuclear translocation of the fusion protein by leptin could also be demonstrated (Fig. 3B). These results demonstrate that leptin induces nuclear translocation of STAT3 and STAT5b molecules in insulin-producing INS-1 -cells in response to activation of the JAK-STAT signaling pathway.
STAT3 and STAT5b transactivate, whereas leptin represses the rat preproinsulin 1 promoter.
We next examined whether leptin-mediated activation of STAT molecules directly exerts the previously demonstrated inhibitory transcriptional effects of leptin at the rat preproinsulin 1 promoter in INS-1 cells. Cotransfection of a STAT3 or STAT5b expression plasmid with a luciferase reporter gene under the control of the rat preproinsulin 1 promoter in INS-1 cells leads to enhanced transcriptional activity of the preproinsulin promoter in comparison with the empty expression plasmid pcDNA3.1- (Fig. 4A). In contrast, leptin treatment of INS-1 cells expressing the rat preproinsulin 1 promoter luciferase reporter lead to significant repression of preproinsulin promoter activity (Fig. 4B). These results suggest that leptin-dependent repression of preproinsulin promoter activity in insulin-producing cells is not mediated by direct interaction of STAT3 or STAT5b with the preproinsulin promoter.
Leptin induces SOCS3 expression in pancreatic -cells by STAT-mediated promoter activation.
We detected induction of steady-state rat SOCS3 mRNA levels by leptin in a time-dependent fashion as early as 30 min after stimulation in INS-1 cells (Fig. 5A). Similarly, strong induction of human SOCS3 mRNA expression was observed in human pancreatic islets that were incubated with leptin for 12 h, whereas basal levels of SOCS3 mRNA in human islets were barely detectable (Fig. 5B). Finally, we observed a time-dependent increase in SOCS3 mRNA expression in islets sequentially isolated at different time points from ob/ob mice that were previously injected intraperitoneally in vivo with murine leptin (Fig. 5C). These results indicate that, similar to the hypothalamus, SOCS3 expression is induced by leptin in pancreatic -cell lines and pancreatic islets in vitro, but also in vivo. The data further imply that SOCS3 may also be involved in leptin signaling in the human endocrine pancreas.
SOCS3 expression has been demonstrated to be regulated through the JAK-STAT signaling pathway. Thus, we tested putative STAT-dependent transcriptional effects of leptin on rat SOCS3 promoter activity. Leptin stimulated rSOCS3 promoter activity in INS-1 cells (Fig. 6A), indicating that induction of the JAK-STAT inhibitory molecule SOCS3 in INS-1 cells by leptin is mediated through transcriptional effects at the promoter level. When the luciferase reporter gene under the control of the rat SOCS3 promoter was cotransfected with expression vectors for the isoforms STAT3 (Fig. 6B) or STAT5b (Fig. 6C) in INS-1 cells, the activity of the rat SOCS3 promoter was strongly induced. These results support the notion that leptin-induced specific STAT activation may induce SOCS3 expression in pancreatic -cells.
Leptin induces DNA binding of STAT3 and STAT5b to specific STAT-response elements in the rat SOCS3 promoter in pancreatic -cells.
Because the rSOCS3 promoter contains DNA sequences homologous to STAT-responsive elements (STATREs) within other promoters (30), we investigated whether leptin induces specific DNA binding of STATs to these STATREs in the rSOCS3 promoter in insulin-producing pancreatic -cells. When the most distal STATRE-containing oligonucleotide (A-STAT), corresponding to sequence of eC363 to eC332 bp of the rSOCS3 promoter, and the most proximal STATRE-containing oligonucleotide (C-STAT), corresponding to sequence of eC83 to eC52 bp of the rSOCS3 promoter, were incubated with in vitroeCtranscribed and translated pure STAT5b protein, specific retardation of the respective oligonucleotide was detected (Fig. 7A). The STAT proteineCDNA complexes were abolished by competition with a 10-fold excess of unlabeled oligonucleotide, and complexes were supershifted by addition of STAT5b-specific antiserum, confirming specificity of binding. In similar experiments, no protein binding of in vitroeCtranscribed and translated STAT3 protein to A-STAT and C-STAT was detectable, indicating isoform specificity of these promoter regions (data not shown).
When the oligonucleotide B-STAT corresponding to sequence eC107 to eC75 of the rSOCS3 promoter was incubated with nuclear extracts of leptin-treated INS-1 cells, a single protein-DNA complex was observed (Fig. 7B). This DNA-binding complex increased in a time-dependent manner upon leptin stimulation with a maximum after 6 h. In competition experiments with a 100-fold excess of unlabeled oligonucleotide, the complex disappeared, indicating specificity for the B-STAT oligonucleotide. In supershift experiments with specific antisera for STAT1, STAT3, and STAT5b, the DNA-binding complex was identified as endogenous STAT3 in INS-1 cells, because formation of the complex was abolished by the STAT3 antiserum. These results indicate that the STATRE within the promoter region comprising B-STAT exerts specificity exclusively for STAT3.
These results suggest that leptin induces expression of SOCS3 in pancreatic -cells via transcriptional induction of rSOCS3 promoter activity that involves specific DNA binding of the transcription factors STAT3 and STAT5b. Although this remains to be definitively shown by detailed promoter analysis involving site-directed mutagenesis, it has previously been demonstrated that these multiple STAT binding sites are important for basal and stimulated SOCS3 promoter activity (30,31).
SOCS3 inhibits basal and STAT3- and STAT5b-dependent transactivation of the rINS-1 promoter.
In Fig. 4A, we demonstrate that STAT3 and STAT5b transactivate eC410 bp of the rat preproinsulin 1 promoter in INS-1 cells. This is in contrast to studies in which leptin suppresses insulin secretion and preproinsulin gene expression (3eC6), indicating that the inhibitory effects of leptin at the rat preproinsulin 1 promoter are not mediated by direct STAT3 or STAT5b action. However, we find that SOCS3 overexpression in INS-1 cells inhibits basal (Fig. 8A) and STAT3-dependent (Fig. 8B) as well as STAT5b-dependent (Fig. 8C) transactivation of the rat preproinsulin 1 promoter. These results provide evidence that in pancreatic -cells, leptin induces SOCS3 expression by STAT3- and STAT5b-dependent transcriptional activation of the SOCS3 promoter, which in turn acts as an inducible negative regulator to restrict basal, but also STAT3- and STAT5b-dependent, activation of the rat preproinsulin 1 promoter.
DISCUSSION
Previous studies have identified STAT3 signaling in the hypothalamus as particularly essential for leptin regulation of energy balance (32,33). In INS-1 cells, a model for insulin-producing -cells, we demonstrated that leptin leads to recruitment and phosphorylation of STAT3 and STAT5b by the leptin receptoreCassociated kinase JAK2 (Fig. 2). Consequently, we demonstrated leptin-mediated time-dependent nuclear translocation of STAT3 and STAT5b in INS-1 -cells (Fig. 3), suggesting that in pancreatic -cells, STAT3 and STAT5b seem to be the major mediators involved in leptin-induced JAK-STAT signaling.
Leptin inhibits insulin biosynthesis by transcriptional repression of the preproinsulin gene promoter, and it has been suggested that STAT molecules acting via STATREs within the rat preproinsulin 1 promoter may be directly involved (6). However, a previous study indicated that growth hormoneeCmediated STAT5b binding to the STAT element within the rat preproinsulin promoter causes activation (34). In agreement, we found that STAT5b and STAT3 activate the eC410rINS-1 promoter in INS-1 cells, whereas leptin is inhibitory (Fig. 4). This suggests that transcriptional inhibition of insulin biosynthesis by leptin involves signaling molecules different from, or in concert with, STAT3 and STAT5b.
Expression of SOCS3, an inhibitor of the JAK-STAT signaling pathway, has been demonstrated to be induced in the hypothalamus of ob/ob mice after peripheral leptin administration (16). There are several putative STAT binding sites in the SOCS3 promoter, and expression of SOCS proteins is induced by cytokines and hormones via STAT activation (30). SOCS3 induced by leptin binds to the leptin receptoreCassociated kinase JAK2 in a leptin-dependent manner in vitro, antagonizes kinase activity, and thereby attenuates proximal leptin signaling through the JAK-STAT pathway (17). Intriguingly, another SOCS protein, SOCS7, has recently been shown to act as an inhibitor of leptin-activated STAT3 and STAT5 signaling by abolishing their translocation to the nucleus (35). We found that SOCS molecules may also represent candidate mediators of leptin-dependent inhibition of insulin promoter activity in pancreatic -cells.
In accordance with the results obtained in the hypothalamus, we were able to demonstrate that leptin induces SOCS3 expression in pancreatic -cells, mediated through transcriptional activation of the SOCS3 promoter by STAT3 and STAT5b. Thus, we identified SOCS3 as a leptin-induced signaling molecule in pancreatic -cells. Intriguingly, we found that SOCS3 inhibits the basal activity of eC410 bp of the rat preproinsulin 1 promoter in addition to the promoter activity stimulated by STAT3 and STAT5b in INS-1 -cells. This raises the possibility that SOCS3 has signaling activities in -cells beyond that of serving as a feedback inhibitor of leptin signaling. This notion is supported by our observation that leptin inhibits preproinsulin gene expression, whereas STAT3 and STAT5b are transcriptional activators. Thus, we propose that SOCS3 not only represents a leptin-induced negative regulator of proximal leptin receptor signaling in an autoregulatory feedback loop, but it is also an important mediator of more distal signaling pathways.
Although, to date, the nature of alternative signaling pathways that may be affected by SOCS3 in pancreatic -cells is unknown, SOCS molecules are emerging as constituents of signal transduction pathways different from JAK-STAT (36). For example, it has recently been shown that SOCS3 can interfere with insulin signaling in muscle, liver, and adipose tissue, possibly by inhibition of tyrosine phosphorylation of insulin receptor substrate proteins (37). In addition, SOCS3 recently has been demonstrated to complex with the insulin receptor in pancreatic -cells, leading to reduced insulin receptor autophosphorylation and impaired signaling through the insulin receptor substrate/phosphatidylinositol 3-kinase pathway (38). Given that the insulin signaling pathway can regulate proinsulin gene expression, it is possible that leptin-induced SOCS3 expression in -cells suppresses proinsulin gene expression by interfering with insulin signaling in the endocrine pancreas. This hypothesis, however, requires further proof by future experiments.
Whether SOCS3 has similar additional signaling roles downstream of JAK-STAT in the hypothalamus warrants investigation. This is particularly relevant given that, in light of the proposed role of SOCS3 in leptin resistance (16,17), SOCS3 inhibitors have been proposed as drug targets to improve leptin sensitivity and thereby treat obesity (19,39,40).
The results presented in this study provide a molecular mechanism by which leptin inhibits preproinsulin gene expression. In particular, we define a novel role for the signaling molecule SOCS3 as a key mediator of leptin action in -cells. Whether inhibition of preproinsulin gene transcription through this signaling pathway also translates into reduction of insulin biosynthesis and secretion, which has been demonstrated before in pancreatic -cells, remains to be shown. If so, attenuated signaling through this pathway in leptin-resistant individuals may contribute to hyperinsulinemia associated with obesity and the development of the metabolic syndrome and type 2 diabetes.
ACKNOWLEDGMENTS
J.S. has received support from the German Diabetes Association (Deutsche Diabetes-Gesellschaft). X.N. has received support from the German Academic Exchange Service. T.J.K. has received support from the Canadian Institutes of Health Research, is a Michael Smith Foundation for Health Research Scholar, and has received a Career Development Award from the Juvenile Diabetes Research Foundation.
Rat STAT5b cDNA cloned into an expression plasmid pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX). The plasmid encoding a GFP-Stat5b fusion protein was provided by Dr. Carter-Su (Baylor College of Medicine). We thank J. Roller for expert technical assistance.
FOOTNOTES
F.J. is currently affiliated with the Department of Experimental and Clinical Osteology, Orthopedic Department, University of We箁zburg, We箁zburg, Germany.
REFERENCES
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM: Positional cloning of the mouse obese gene and its human homologue. Nature 372:425eC432, 1994
Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL: Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334:292eC295, 1996
Fehmann HC, Berghofer P, Brandhorst D, Brandhorst H, Hering B, Bretzel RG, Goke B: Leptin inhibition of insulin secretion from isolated human islets. Acta Diabetol 34:249eC252, 1997
Fehmann HC, Peiser C, Bode HP, Stamm M, Staats P, Hedetoft C, Lang RE, Goke B: Leptin: a potent inhibitor of insulin secretion. Peptides 18:1267eC1273, 1997
Seufert J, Kieffer TJ, Leech CA, Holz GG, Moritz W, Ricordi C, Habener JF: Leptin suppression of insulin secretion and gene expression in human pancreatic islets: implications for the development of adipogenic diabetes mellitus. J Clin Endocrinol Metab 84:670eC676, 1999
Seufert J, Kieffer TJ, Habener JF: Leptin inhibits insulin gene transcription and reverses hyperinsulinemia in leptin-deficient ob/ob mice. Proc Natl Acad Sci U S A 96:674eC679, 1999
Kieffer TJ, Habener JF: The adipoinsular axis: effects of leptin on pancreatic beta-cells. Am J Physiol Endocrinol Metab 278:E1eCE14, 2000
Seufert J: Leptin effects on pancreatic -cell gene expression and function. Diabetes 53 (Suppl. 1):S152eCS158, 2004
Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J: Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263eC1271, 1995
Rosenblum CI, Tota M, Cully D, Smith T, Collum R, Qureshi S, Hess JF, Phillips MS, Hey PJ, Vongs A, Fong TM, Xu L, Chen HY, Smith RG, Schindler C, Van der Ploeg LH: Functional STAT 1 and 3 signaling by the leptin receptor (OB-R): reduced expression of the rat fatty leptin receptor in transfected cells. Endocrinology 137:5178eC5181, 1996
Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Kim H, Lai CF, Tartaglia LA: The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci U S A 93:8374eC8378, 1996
Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM: Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632eC635, 1996
Kieffer TJ, Heller RS, Habener JF: Leptin receptors expressed on pancreatic beta-cells. Biochem Biophys Res Commun 224:522eC527, 1996
Darnell JE Jr: STATs and gene regulation. Science 277:1630eC1635, 1997
Krebs DL, Hilton DJ: SOCS: physiological suppressors of cytokine signaling. J Cell Sci 113:2813eC2819, 2000
Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS: Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619eC625, 1998
Bjorbaek C, El Haschimi K, Frantz JD, Flier JS: The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274:30059eC30065, 1999
Bjorbak C, Lavery HJ, Bates SH, Olson RK, Davis SM, Flier JS, Myers MG Jr: SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J Biol Chem 275:40649eC40657, 2000
Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura H, Torisu T, Chien KR, Yasukawa H, Yoshimura A: Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10:739eC743, 2004
Munzberg H, Flier JS, Bjorbaek C: Region-specific leptin resistance within the hypothalamus of diet-induced obese mice. Endocrinology 145:4880eC4889, 2004
Tups A, Ellis C, Moar KM, Logie TJ, Adam CL, Mercer JG, Klingenspor M: Photoperiodic regulation of leptin sensitivity in the Siberian hamster, Phodopus sungorus, is reflected in arcuate nucleus SOCS-3 (suppressor of cytokine signaling) gene expression. Endocrinology 145:1185eC1193, 2004
Ueki K, Kondo T, Tseng YH, Kahn CR: Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad Sci U S A 101:10422eC10427, 2004
Asfari M, Janjic D, Meda P, Li G, Halban PA, Wollheim CB: Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130:167eC178, 1992
Herrington J, Rui L, Luo G, Yu-Lee LY, Carter-Su C: A functional DNA binding domain is required for growth hormone-induced nuclear accumulation of Stat5B. J Biol Chem 274:5138eC5145, 1999
Seufert J, Weir GC, Habener JF: Differential expression of the insulin gene transcriptional repressor CCAAT/enhancer-binding protein beta and transactivator islet duodenum homeobox-1 in rat pancreatic beta cells during the development of diabetes mellitus. J Clin Invest 101:2528eC2539, 1998
Schreiber E, Matthias P, Muller MM, Schaffner W: Rapid detection of octamer binding proteins with ‘mini-extracts,’ prepared from a small number of cells. Nucleic Acid Res 17: 6419, 1989
Lu M, Seufert J, Habener JF: Pancreatic beta-cell-specific repression of insulin gene transcription by CCAAT/enhancer-binding protein beta: inhibitory interactions with basic helix-loop-helix transcription factor E47. J Biol Chem 272:28349eC28359, 1997
Brasier AR, Tate JE, Habener JF: Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7:1116eC1122, 1989
Bjorbaek C, Uotani S, da Silva B, Flier JS: Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272:32686eC32695, 1997
Auernhammer CJ, Bousquet C, Melmed S: Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci U S A 96:6964eC6969, 1999
Paul C, Seiliez I, Thissen JP, Le Cam A: Regulation of expression of the rat SOCS-3 gene in hepatocytes by growth hormone, interleukin-6 and glucocorticoids mRNA analysis and promoter characterization. Eur J Biochem 267:5849eC5857, 2000
Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers MG Jr: STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856eC859, 2003
Gao Q, Wolfgang MJ, Neschen S, Morino K, Horvath TL, Shulman GI, Fu XY: Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. Proc Natl Acad Sci U S A 101:4661eC4666, 2004
Galsgaard ED, Gouilleux F, Groner B, Serup P, Nielsen JH, Billestrup N: Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene. Mol Endocrinol 10:652eC660, 1996
Martens N, Uzan G, Wery M, Hooghe R, Hooghe-Peters EL, Gertler A: Suppressor of cytokine signaling 7 inhibits prolactin, growth hormone, and leptin signaling by interacting with STAT5 or STAT3 and attenuating their nuclear translocation. J Biol Chem 280:13817eC13823, 2005
Krebs DL, Hilton DJ: A new role for SOCS in insulin action: suppressor of cytokine signaling (Review). Sci STKE 2003:PE6, 2003
Ueki K, Kondo T, Kahn CR: Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24:5434eC5446, 2004
Emanuelli B, Glondu M, Filloux C, Peraldi P, Van Obberghen E: The potential role of SOCS-3 in the interleukin-1eCinduced desensitization of insulin signaling in pancreatic -cells. Diabetes 53 (Suppl. 3):S97eCS103, 2004
Howard JK, Cave BJ, Oksanen LJ, Tzameli I, Bjorbaek C, Flier JS: Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10:734eC738, 2004
Myers MG Jr: Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog Horm Res 59:287eC304, 2004(Katharina Laubner, Timoth)
2 Laboratory of Molecular and Cellular Medicine, the Departments of Cellular and Physiological Sciences and Surgery, University of British Columbia, Vancouver, British Columbia, Canada
GFP, green fluorescent protein; JAK, janus kinase; PY, anti-phosphotyrosine; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; STATRE, STAT-responsive element
ABSTRACT
Leptin inhibits insulin secretion and preproinsulin gene expression in pancreatic -cells, but signal transduction pathways and molecular mechanisms underlying this effect are poorly characterized. In this study, we analyzed leptin-mediated signal transduction and preproinsulin gene regulation at the molecular level in pancreatic -cells. Leptin stimulation led to janus kinase (JAK)2-dependent phosphorylation and nuclear translocation of the transcription factors signal transducer and activator of transcription (STAT)3 and STAT5b in INS-1 -cells. Leptin also induced mRNA expression of the JAK-STAT inhibitor suppressor of cytokine signaling (SOCS)3 in INS-1 -cells and human pancreatic islets in vitro and in pancreatic islets of ob/ob mice in vivo. Transcriptional activation of the rat SOCS3 promoter by leptin was observed with concomitant leptin-induced STAT3 and STAT5b DNA binding to specific promoter regions. Unexpectedly, SOCS3 inhibited both basal and STAT3/5b-dependent rat preproinsulin 1 gene promoter activity in INS-1 cells. These results suggest that SOCS3 represents a transcriptional inhibitor of preproinsulin gene expression, which is induced by leptin through JAK-STAT3/5b signaling in pancreatic -cells. In conclusion, although SOCS3 is believed to be a negative feedback regulator of JAK-STAT signaling, our findings suggest involvement of SOCS3 in a direct gene regulatory pathway downstream of leptin-activated JAK-STAT signaling in pancreatic -cells.
The hormone leptin is the product of the obese (ob) gene, primarily produced by white adipose tissue (1) and typically circulates in proportion to body fat mass (2). Leptin acts on specific regions in the hypothalamus to inhibit food intake and raise energy expenditure. Elevated leptin levels in obese subjects are believed to be indicative of resistance to leptin. Leptin has also been shown to inhibit insulin secretion and preproinsulin gene expression in pancreatic -cells (3eC6), thereby establishing an adipoinsular feedback loop in concert with stimulatory action of insulin on leptin secretion from the adipose tissue (7,8). Dysregulation of this adipoinsular axis with the establishment of leptin resistance in pancreatic -cells may lead to hyperinsulinemia, which could contribute to obesity and insulin resistance.
Leptin signal transduction occurs through a distinct receptor of the class 1 cytokine superfamily of receptors (9), which is intracellularly coupled to the janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway (10). Several leptin receptor (ObR) isoforms are known, but the majority of physiological effects appear to be mediated via the longest form (ObRb) (11,12). In previous experiments, we and others have demonstrated that ObR isoforms, including ObRb, are expressed and functional in pancreatic -cell lines and primary pancreatic islets (3,13). Binding of leptin to ObRb activates the receptor-associated kinase JAK2 via transphosphorylation and phosphorylates tyrosine residues on ObRb. Subsequently, transcription factors of the STAT family are recruited to the receptor and also phosphorylated. Phosphorylated STATs dimerize and translocate to the nucleus to regulate gene transcription (14). STATs have mainly been shown to transcriptionally enhance gene expression. However, we previously determined that leptin increases binding of STAT5b to the upstream sequences of the rat preproinsulin 1 promoter (6) and inhibits insulin biosynthesis via transcriptional repression (5). In this study, we sought to characterize this apparent contradiction at the molecular level.
Suppressors of cytokine signaling (SOCS) belong to a family of molecules that inhibit cytokine signaling by inhibiting JAK-STAT signal transduction. These molecules contain a central Src-homology 2 domain and a conserved COOH-terminal SOCS box. Through the Src-homology 2 domain, they bind directly to tyrosine-phosphorylated residues on the cytokine receptoreCassociated kinase JAK2, which blocks the access of STATs to receptor binding sites and leads to inactivation of the JAKs (15). Expression of SOCS proteins is induced by various cytokines and hormones, including interleukin-6, leukemia inhibitory factor, erythropoietin, growth hormone, and leptin (16eC18). Accumulating evidence suggests that SOCS3 is a leptin-induced negative feedback regulator of leptin receptor signaling that may be involved in the development of leptin resistance in the hypothalamus (16eC22).
Here, we provide evidence that leptin induces SOCS3 expression in pancreatic -cells by transcriptional mechanisms involving transcription factors of the STAT family. Moreover, we discovered that SOCS3 reduces preproinsulin gene expression in pancreatic -cells that was previously attributed directly to leptin activation of STAT molecules. Thus, we provide a molecular mechanism by which leptin confers inhibitory effects at the level of preproinsulin gene promoter activity, and we thereby extend the function of SOCS3 beyond that of a feedback inhibitor of JAK-STAT signaling.
RESEARCH DESIGN AND METHODS
Cell lines and culture conditions.
The rat insulinoma cell line INS-1 was obtained from Dr. Claes B. Wollheim (University of Geneva, Switzerland) and grown as reported previously (23). Cells were deprived of serum and antibiotics for a 12- to 15-h period before they were stimulated with murine leptin (Recombinant Mouse Leptin; R & D Systems, Minneapolis, MN) at concentrations of 0.625 nmol/l (10 ng/ml) for different time periods.
RNA isolation and RT-PCR for STAT mRNA in pancreatic -cells.
Total RNA from the INS-1 rat pancreatic -cell line was extracted using TRIZOL reagent (Invitrogen Life Technologies, Gaithersburg, MD) and subjected to DNase I digest. Digested RNA was reverse transcribed by oligo-dT priming with reverse transcriptase (Superscript; Invitrogen Life Technologies). After reverse transcription, the cDNA was subjected to PCR amplification for STAT1, -2, -3, -4, -5a, -5b, and -6 using sequence-specific oligonucleotides (STAT1: sense, 5'-TGAACTCCATCGAGCTCACTCAGAACACT-3', and antisense, 5'-AGAGGACGAAGGTGCGATCGGATAAC-3' [264-bp PCR product; GenBank accession number AF053767]; STAT2: sense, 5'-GAAGGGGGCATTACTTGTTCTTGGGTGGAG-3', and antisense, 5'-GCGGATGATCTCTGCCAGTGGGAGTGAC-3' [140-bp PCR product; GenBank accession number BC064827]; STAT3: sense, 5'-TGGAAGAGGCGGCAGCAGATAGC-3', and antisense, 5'-GCACGGCCCCCATTCCCACAT-3' [545-bp PCR product; GenBank accession number X91810]; STAT4: sense, 5'-AAACTATGGCAACAATTCTCCTTCAAAAC-3', and antisense, 5'-GCCGCAGCCAGTATTCTCCTCTC-3' [208-bp PCR product; GenBank accession number AF055291]; STAT5a: sense, 5'-GCAACATTTCCCCATCGAGGTCCGGCACTACC-3', and antisense, 5'-GTGGCCTGGCCTCGGTCCTGGGGATTG-3' [105-bp PCR product; GenBank accession number U24175]; STAT5b: sense, 5'-GCCAGCATTTCCCCATCGAGGTGCGACATTATTTA-3', and antisense, 5'-GTCATACGTGTTCTGGAGCTGCGTGGCATAGTGC-3' [230-bp PCR product; GenBank accession number X97541]; STAT6: sense, 5'-CCAGCCGGGGACTGCTACCAGAACACTTC-3', and antisense, 5'-CCGGATGACATGGGCAATGGTGATGC-3' [341-bp PCR product; GenBank accession number AF055292]) according to the following conditions: 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C (36 cycles). Identity of the PCR products was confirmed by sequencing (data not shown).
Immunoprecipitation and Western blotting.
After stimulation of INS-1 cells with leptin (10 ng/ml) at 30 min, 3 h, and 6 h, whole-cell extracts were prepared in ELB buffer (100 mmol/l NaCl, 0.1% NP-40, 50 mmol/l Hepes, 1 mmol/l phenylmethylsulfonyl fluoride, 5 mmol/l EDTA, and 0.5 mmol/l dithiothreitol). Equal amounts of protein were immunoprecipitated at 4°C with antisera specific for JAK2, STAT3, or STAT5b (Santa Cruz Biotechnology, Santa Cruz, CA) overnight followed by incubation with protein A-Sepharose for 1 h. Immunoprecipitated proteins were separated by a 12% SDS polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were probed with a mouse monoclonal anti-phosphotyrosine antibody (clone 4G10; Upstate Biotechnology, Lake Placid, NY) or antisera specific for STAT3 or STAT5b, respectively.
Immunocytochemistry and green fluorescent protein studies.
INS-1 cells were grown on coverslips, serum deprived overnight, stimulated with leptin (10 ng/ml) for different time periods, fixed with 4% paraformaldehyde, and permeabilized with eC20°C methanol. Slides were then incubated with STAT3 or STAT5b rabbit antisera (Santa Cruz Biotechnology) for 1eC2 h at room temperature and then incubated with a fluorescent secondary antiserum coupled to indocarbocyanide. Microscopic imaging was performed on a Zeiss epifluorescent microscope coupled to an Optronics TEC-470 CCD camera interfaced with digital imaging analysis software (IP-Lab Spectrum; Signal Analytics, Vienna, VA) on a power Macintosh computer.
For green fluorescent protein (GFP) studies, INS-1 cells were stably transfected (Transfast; Promega, Mannheim, Germany) with a cDNA encoding a GFP-Stat5b fusion protein (provided by Dr. Carter-Su, Baylor College of Medicine, Houston, TX) (24). Cells were incubated at 37°C in serum-free media for 30 min before incubation with vehicle or murine leptin (10 ng/ml; PeproTech, Rocky Hill, NJ) for 15 min. Imaging was performed by exciting GFP at 488 nm using a Leica DMIRB microscope. For every dish, 20 cells were imaged. For quantitative analysis of fluorescence distribution, images were captured via a CoolSnap camera (RS Photometrics, Tucson, AZ), and intensity values of neighboring nuclear and cytosolic regions were calculated using IP-Lab software. The nuclear-to-cytosol ratio of fluorescence was calculated in images captured from four separate experiments. Statistical significance was determined by ANOVA analysis.
Expression of SOCS3 mRNA in INS-1 cells, human pancreatic islets, and pancreatic islets of ob/ob mice.
mRNA was extracted from rat INS-1 pancreatic -cells after incubation with 10 ng/ml murine leptin (Recombinant Mouse Leptin; R & D Systems) for the indicated time periods. Human pancreatic islet cDNA was reverse transcribed from mRNA that was extracted from human islets after incubation with 10 ng/ml human leptin (PeproTech) or vehicle for the indicated time period during an earlier study (5). Ob/ob mice (n = 4 per time point) were injected intraperitoneally in vivo with murine leptin (Recombinant Mouse Leptin; R & D Systems) at 1 e蘥/g body wt or vehicle, and pancreatic islets were isolated at different time points after intraperitoneal injection for mRNA extraction as previously described (6). Semiquantitative RT-PCR for rat, human, and mouse SOCS3 mRNA and -actin were performed as described previously (5,25). The primers used for amplification of rat SOCS3 were sense, 5'-GCTCCGTGCGCCATGGTCACCCACAG-3', and antisense, 5'-CTTTGCTCTTTAAAGTGGAGCATCATACTG-3'; 699-bp PCR product (GenBank accession number AJ249240). Primer oligonucleotides used for amplification of human SOCS3 were sense, 5'-CGCCACTTCTTCACGCTCAG-3', and antisense, 5'-AGGGGCCGGCTCAACACC-3'; 317-bp PCR product (GenBank accession number AF159854). The primer oligonucleotides for murine SOCS3 were sense, 5'-GACACCAGCCTGCGCCTCAAGAC-3', and antisense, 5'-CCGGAACTTCGGACGAGGGTTCC-3'; 397-bp PCR product (GenBank accession number AF314501). PCR conditions were 2 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 57°C (30 s at 60°C for human SOCS3), and 30 s at 72°C (18 cycles, 22 cycles for human SOCS3). All results are derived from at least three independent experiments.
Nuclear extracts and electrophoretic mobility shift assay.
INS-1 cells were serum deprived overnight before stimulation with 10 ng/ml leptin. Nuclear extracts were prepared as described previously (26). In vitroeCtranslated STAT5b was obtained from the plasmid STAT5bpcDNA3.1- using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer’s protocol. Ten micrograms nuclear extract or 5 e蘬 TNT in vitro translation reaction were added to 5x electrophoretic mobility shift assay buffer (100 mmol/l KPO4, pH 7.9, 5 mmol/l EDTA, 5 mmol/l dithiothreitol, and 20% glycerol), 50 mmol/l KCl, 1 e蘥 poly-dIdC, and 40,000 cpm/e蘬 32P-labeled double-stranded oligonucleotide. DNA probes were generated by annealing two oligonucleotides, followed by a fill-in reaction with Klenow polymerase and dGTP, dCTP, dTTP, and [-32P]dATP. The oligonucleotide sequence corresponding to a sequence from eC363 to eC332 bp of the rat SOCS3 promoter, containing a eC351- to eC344-bp putative STAT binding site, named A-STAT, was 5'-363AGAAACCAGCCTTCTTAGAAGGGAGGGGGTGGeC332-3'. The oligonucleotide sequence corresponding to a sequence from eC107 to eC75 bp of the rat SOCS3 promoter, containing a eC95- to eC87-bp putative STAT binding site, named B-STAT, was 5'-eC107AGTGACTAAACATTACAAGAAGACCGGCCGCGCeC75-3'. The oligonucleotide sequence corresponding to a sequence from eC82 to eC52 bp of the rat SOCS3 promoter, containing a eC72- to eC64-bp putative STAT binding site, named C-STAT, was: 5'-eC83CGGCCGCGCAGTTCCAGGAATCGGGGGGGCGGeC52-3' (GenBank accession number AJ249240). After incubation on ice for 15 min, the samples were loaded onto a 5% polyacrylamide gel and run in 0.5x Tris-borate-EDTA buffer for 2 h. For supershift assays, 4 e蘬 of STAT1, STAT3, or STAT5b antisera (Santa Cruz Biotechnology) was added before samples were loaded onto the gel.
Plasmids, transient DNA transfection, and luciferase assays.
The plasmid eC1054rSOCS3pGL3 contains a fragment of the rat SOCS3 promoter between base pairs eC1,054 and 222. It was generated by PCR from rat genomic DNA and cloned into the luciferase reporter vector pGL3 (Promega). The plasmid eC410rINS-1 contains 410 bp of the promoter region of the rat preproinsulin 1 gene also cloned into the luciferase reporter vector pGL3 (Promega) (27). The rSOCS3pcDNA3.1- expression plasmid contains the full-length coding sequence of rat SOCS3. Identity of all vectors has been confirmed by sequencing. Rat STAT5b pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX).
INS-1 -cells were transfected using Lipofectamine (Invitrogen Life Technologies) and 2 e蘥 eC1054rSOCS3pGL3 vector in duplicate samples in serum-free medium and incubated with 10 ng/ml leptin or vehicle. For cotransfection experiments, INS-1 -cells were cotransfected with 2 e蘥 eC410rINS-1pGL3 vector and 1,000 ng rSTAT5bpcDNA3.1- and rSOCS3pcDNA3.1- in duplicates. Luciferase expression was measured after 12 h as described previously (28). Data shown in each figure are mean values ± SE of at least six independent experiments and are normalized to protein concentrations.
RESULTS
Expression of STAT isoforms in pancreatic -cells.
We found abundant mRNA expression for the isoforms STAT1 as well as STAT3, STAT5b, and STAT6 in this insulin-producing pancreatic -cell line (Fig. 1), whereas mRNA expression for the isoforms STAT2, STAT4, and STAT5a was not detectable. These results indicate that constituents of the JAK-STAT signaling pathway that have been shown to be involved in leptin signaling in other tissues (10,29) are expressed in the INS-1 -cell line.
Leptin induces phosphorylation of STAT3 and STAT5b through receptor-associated JAK2 in INS-1 -cells.
To test whether the JAK-STAT signaling pathway is activated by leptin in insulin-producing cells, immunoprecipitation experiments were performed in leptin-treated INS-1 cells. As shown in Fig. 2A, leptin treatment of serum-deprived INS-1 -cells induces tyrosine phosphorylation of leptin receptoreCassociated JAK2 in a time-dependent manner while the total amount of precipitated JAK2 protein remained constant (Fig. 2A, bottom panel). When JAK2 immunoprecipitates from leptin-treated INS-1 cells were immunoblotted with antisera specific for STAT3 (Fig. 2B, top panel) and STAT5b (Fig. 2C, upper panel), recruitment and association of STAT3 and STAT5b to JAK2 was observed as early as 30 min after leptin stimulation. Subsequent to the recruitment of STAT3 and STAT5b to JAK2, time-dependent tyrosine phosphorylation of these transcription factors was observed (Figs. 2B and C, middle panels). Immunoblotting of STAT3 and STAT5b immunoprecipitates from leptin-treated INS-1 cells with either STAT3-specific (Fig. 2B, bottom panel) or STAT5b-specific (Fig. 2C, bottom panel) antisera revealed equal total amount of STAT precipitates throughout the time course of the experiments. These results indicate that STAT3 and STAT5b coimmunoprecipitate with JAK2 in a phosphorylation-dependent fashion after leptin stimulation and suggest phosphotyrosine-mediated protein interaction of JAK2 and STAT3 and STAT5b in leptin-treated -cells. Co-immunoprecipitation of the other isoforms of STAT molecules (STAT1 and STAT6), which are also expressed in INS-1 cells (Fig. 1), with JAK2 was not detected (data not shown).
Leptin induces nuclear translocation of STAT3 and STAT5b in INS-1 -cells.
As shown in Fig. 3A, we find STAT3 (Fig. 3A, top panel) as well as STAT5b (Fig. 3A, bottom panel) molecules in the nucleus as early as 30 min after leptin treatment in the majority of cells. Nuclear predominance of STAT molecule localization continued up to 3 h after a single leptin application, whereas after 6 h, subcellular localization was predominantly cytoplasmic again in the majority of cells. In INS-1 cells stably overexpressing a GFP-STAT5b fusion protein, significant nuclear translocation of the fusion protein by leptin could also be demonstrated (Fig. 3B). These results demonstrate that leptin induces nuclear translocation of STAT3 and STAT5b molecules in insulin-producing INS-1 -cells in response to activation of the JAK-STAT signaling pathway.
STAT3 and STAT5b transactivate, whereas leptin represses the rat preproinsulin 1 promoter.
We next examined whether leptin-mediated activation of STAT molecules directly exerts the previously demonstrated inhibitory transcriptional effects of leptin at the rat preproinsulin 1 promoter in INS-1 cells. Cotransfection of a STAT3 or STAT5b expression plasmid with a luciferase reporter gene under the control of the rat preproinsulin 1 promoter in INS-1 cells leads to enhanced transcriptional activity of the preproinsulin promoter in comparison with the empty expression plasmid pcDNA3.1- (Fig. 4A). In contrast, leptin treatment of INS-1 cells expressing the rat preproinsulin 1 promoter luciferase reporter lead to significant repression of preproinsulin promoter activity (Fig. 4B). These results suggest that leptin-dependent repression of preproinsulin promoter activity in insulin-producing cells is not mediated by direct interaction of STAT3 or STAT5b with the preproinsulin promoter.
Leptin induces SOCS3 expression in pancreatic -cells by STAT-mediated promoter activation.
We detected induction of steady-state rat SOCS3 mRNA levels by leptin in a time-dependent fashion as early as 30 min after stimulation in INS-1 cells (Fig. 5A). Similarly, strong induction of human SOCS3 mRNA expression was observed in human pancreatic islets that were incubated with leptin for 12 h, whereas basal levels of SOCS3 mRNA in human islets were barely detectable (Fig. 5B). Finally, we observed a time-dependent increase in SOCS3 mRNA expression in islets sequentially isolated at different time points from ob/ob mice that were previously injected intraperitoneally in vivo with murine leptin (Fig. 5C). These results indicate that, similar to the hypothalamus, SOCS3 expression is induced by leptin in pancreatic -cell lines and pancreatic islets in vitro, but also in vivo. The data further imply that SOCS3 may also be involved in leptin signaling in the human endocrine pancreas.
SOCS3 expression has been demonstrated to be regulated through the JAK-STAT signaling pathway. Thus, we tested putative STAT-dependent transcriptional effects of leptin on rat SOCS3 promoter activity. Leptin stimulated rSOCS3 promoter activity in INS-1 cells (Fig. 6A), indicating that induction of the JAK-STAT inhibitory molecule SOCS3 in INS-1 cells by leptin is mediated through transcriptional effects at the promoter level. When the luciferase reporter gene under the control of the rat SOCS3 promoter was cotransfected with expression vectors for the isoforms STAT3 (Fig. 6B) or STAT5b (Fig. 6C) in INS-1 cells, the activity of the rat SOCS3 promoter was strongly induced. These results support the notion that leptin-induced specific STAT activation may induce SOCS3 expression in pancreatic -cells.
Leptin induces DNA binding of STAT3 and STAT5b to specific STAT-response elements in the rat SOCS3 promoter in pancreatic -cells.
Because the rSOCS3 promoter contains DNA sequences homologous to STAT-responsive elements (STATREs) within other promoters (30), we investigated whether leptin induces specific DNA binding of STATs to these STATREs in the rSOCS3 promoter in insulin-producing pancreatic -cells. When the most distal STATRE-containing oligonucleotide (A-STAT), corresponding to sequence of eC363 to eC332 bp of the rSOCS3 promoter, and the most proximal STATRE-containing oligonucleotide (C-STAT), corresponding to sequence of eC83 to eC52 bp of the rSOCS3 promoter, were incubated with in vitroeCtranscribed and translated pure STAT5b protein, specific retardation of the respective oligonucleotide was detected (Fig. 7A). The STAT proteineCDNA complexes were abolished by competition with a 10-fold excess of unlabeled oligonucleotide, and complexes were supershifted by addition of STAT5b-specific antiserum, confirming specificity of binding. In similar experiments, no protein binding of in vitroeCtranscribed and translated STAT3 protein to A-STAT and C-STAT was detectable, indicating isoform specificity of these promoter regions (data not shown).
When the oligonucleotide B-STAT corresponding to sequence eC107 to eC75 of the rSOCS3 promoter was incubated with nuclear extracts of leptin-treated INS-1 cells, a single protein-DNA complex was observed (Fig. 7B). This DNA-binding complex increased in a time-dependent manner upon leptin stimulation with a maximum after 6 h. In competition experiments with a 100-fold excess of unlabeled oligonucleotide, the complex disappeared, indicating specificity for the B-STAT oligonucleotide. In supershift experiments with specific antisera for STAT1, STAT3, and STAT5b, the DNA-binding complex was identified as endogenous STAT3 in INS-1 cells, because formation of the complex was abolished by the STAT3 antiserum. These results indicate that the STATRE within the promoter region comprising B-STAT exerts specificity exclusively for STAT3.
These results suggest that leptin induces expression of SOCS3 in pancreatic -cells via transcriptional induction of rSOCS3 promoter activity that involves specific DNA binding of the transcription factors STAT3 and STAT5b. Although this remains to be definitively shown by detailed promoter analysis involving site-directed mutagenesis, it has previously been demonstrated that these multiple STAT binding sites are important for basal and stimulated SOCS3 promoter activity (30,31).
SOCS3 inhibits basal and STAT3- and STAT5b-dependent transactivation of the rINS-1 promoter.
In Fig. 4A, we demonstrate that STAT3 and STAT5b transactivate eC410 bp of the rat preproinsulin 1 promoter in INS-1 cells. This is in contrast to studies in which leptin suppresses insulin secretion and preproinsulin gene expression (3eC6), indicating that the inhibitory effects of leptin at the rat preproinsulin 1 promoter are not mediated by direct STAT3 or STAT5b action. However, we find that SOCS3 overexpression in INS-1 cells inhibits basal (Fig. 8A) and STAT3-dependent (Fig. 8B) as well as STAT5b-dependent (Fig. 8C) transactivation of the rat preproinsulin 1 promoter. These results provide evidence that in pancreatic -cells, leptin induces SOCS3 expression by STAT3- and STAT5b-dependent transcriptional activation of the SOCS3 promoter, which in turn acts as an inducible negative regulator to restrict basal, but also STAT3- and STAT5b-dependent, activation of the rat preproinsulin 1 promoter.
DISCUSSION
Previous studies have identified STAT3 signaling in the hypothalamus as particularly essential for leptin regulation of energy balance (32,33). In INS-1 cells, a model for insulin-producing -cells, we demonstrated that leptin leads to recruitment and phosphorylation of STAT3 and STAT5b by the leptin receptoreCassociated kinase JAK2 (Fig. 2). Consequently, we demonstrated leptin-mediated time-dependent nuclear translocation of STAT3 and STAT5b in INS-1 -cells (Fig. 3), suggesting that in pancreatic -cells, STAT3 and STAT5b seem to be the major mediators involved in leptin-induced JAK-STAT signaling.
Leptin inhibits insulin biosynthesis by transcriptional repression of the preproinsulin gene promoter, and it has been suggested that STAT molecules acting via STATREs within the rat preproinsulin 1 promoter may be directly involved (6). However, a previous study indicated that growth hormoneeCmediated STAT5b binding to the STAT element within the rat preproinsulin promoter causes activation (34). In agreement, we found that STAT5b and STAT3 activate the eC410rINS-1 promoter in INS-1 cells, whereas leptin is inhibitory (Fig. 4). This suggests that transcriptional inhibition of insulin biosynthesis by leptin involves signaling molecules different from, or in concert with, STAT3 and STAT5b.
Expression of SOCS3, an inhibitor of the JAK-STAT signaling pathway, has been demonstrated to be induced in the hypothalamus of ob/ob mice after peripheral leptin administration (16). There are several putative STAT binding sites in the SOCS3 promoter, and expression of SOCS proteins is induced by cytokines and hormones via STAT activation (30). SOCS3 induced by leptin binds to the leptin receptoreCassociated kinase JAK2 in a leptin-dependent manner in vitro, antagonizes kinase activity, and thereby attenuates proximal leptin signaling through the JAK-STAT pathway (17). Intriguingly, another SOCS protein, SOCS7, has recently been shown to act as an inhibitor of leptin-activated STAT3 and STAT5 signaling by abolishing their translocation to the nucleus (35). We found that SOCS molecules may also represent candidate mediators of leptin-dependent inhibition of insulin promoter activity in pancreatic -cells.
In accordance with the results obtained in the hypothalamus, we were able to demonstrate that leptin induces SOCS3 expression in pancreatic -cells, mediated through transcriptional activation of the SOCS3 promoter by STAT3 and STAT5b. Thus, we identified SOCS3 as a leptin-induced signaling molecule in pancreatic -cells. Intriguingly, we found that SOCS3 inhibits the basal activity of eC410 bp of the rat preproinsulin 1 promoter in addition to the promoter activity stimulated by STAT3 and STAT5b in INS-1 -cells. This raises the possibility that SOCS3 has signaling activities in -cells beyond that of serving as a feedback inhibitor of leptin signaling. This notion is supported by our observation that leptin inhibits preproinsulin gene expression, whereas STAT3 and STAT5b are transcriptional activators. Thus, we propose that SOCS3 not only represents a leptin-induced negative regulator of proximal leptin receptor signaling in an autoregulatory feedback loop, but it is also an important mediator of more distal signaling pathways.
Although, to date, the nature of alternative signaling pathways that may be affected by SOCS3 in pancreatic -cells is unknown, SOCS molecules are emerging as constituents of signal transduction pathways different from JAK-STAT (36). For example, it has recently been shown that SOCS3 can interfere with insulin signaling in muscle, liver, and adipose tissue, possibly by inhibition of tyrosine phosphorylation of insulin receptor substrate proteins (37). In addition, SOCS3 recently has been demonstrated to complex with the insulin receptor in pancreatic -cells, leading to reduced insulin receptor autophosphorylation and impaired signaling through the insulin receptor substrate/phosphatidylinositol 3-kinase pathway (38). Given that the insulin signaling pathway can regulate proinsulin gene expression, it is possible that leptin-induced SOCS3 expression in -cells suppresses proinsulin gene expression by interfering with insulin signaling in the endocrine pancreas. This hypothesis, however, requires further proof by future experiments.
Whether SOCS3 has similar additional signaling roles downstream of JAK-STAT in the hypothalamus warrants investigation. This is particularly relevant given that, in light of the proposed role of SOCS3 in leptin resistance (16,17), SOCS3 inhibitors have been proposed as drug targets to improve leptin sensitivity and thereby treat obesity (19,39,40).
The results presented in this study provide a molecular mechanism by which leptin inhibits preproinsulin gene expression. In particular, we define a novel role for the signaling molecule SOCS3 as a key mediator of leptin action in -cells. Whether inhibition of preproinsulin gene transcription through this signaling pathway also translates into reduction of insulin biosynthesis and secretion, which has been demonstrated before in pancreatic -cells, remains to be shown. If so, attenuated signaling through this pathway in leptin-resistant individuals may contribute to hyperinsulinemia associated with obesity and the development of the metabolic syndrome and type 2 diabetes.
ACKNOWLEDGMENTS
J.S. has received support from the German Diabetes Association (Deutsche Diabetes-Gesellschaft). X.N. has received support from the German Academic Exchange Service. T.J.K. has received support from the Canadian Institutes of Health Research, is a Michael Smith Foundation for Health Research Scholar, and has received a Career Development Award from the Juvenile Diabetes Research Foundation.
Rat STAT5b cDNA cloned into an expression plasmid pcDNA3.1- was a gift from Dr. L.-Y. Yu-Lee (Baylor College of Medicine, Houston, TX). The plasmid encoding a GFP-Stat5b fusion protein was provided by Dr. Carter-Su (Baylor College of Medicine). We thank J. Roller for expert technical assistance.
FOOTNOTES
F.J. is currently affiliated with the Department of Experimental and Clinical Osteology, Orthopedic Department, University of We箁zburg, We箁zburg, Germany.
REFERENCES
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM: Positional cloning of the mouse obese gene and its human homologue. Nature 372:425eC432, 1994
Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL: Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334:292eC295, 1996
Fehmann HC, Berghofer P, Brandhorst D, Brandhorst H, Hering B, Bretzel RG, Goke B: Leptin inhibition of insulin secretion from isolated human islets. Acta Diabetol 34:249eC252, 1997
Fehmann HC, Peiser C, Bode HP, Stamm M, Staats P, Hedetoft C, Lang RE, Goke B: Leptin: a potent inhibitor of insulin secretion. Peptides 18:1267eC1273, 1997
Seufert J, Kieffer TJ, Leech CA, Holz GG, Moritz W, Ricordi C, Habener JF: Leptin suppression of insulin secretion and gene expression in human pancreatic islets: implications for the development of adipogenic diabetes mellitus. J Clin Endocrinol Metab 84:670eC676, 1999
Seufert J, Kieffer TJ, Habener JF: Leptin inhibits insulin gene transcription and reverses hyperinsulinemia in leptin-deficient ob/ob mice. Proc Natl Acad Sci U S A 96:674eC679, 1999
Kieffer TJ, Habener JF: The adipoinsular axis: effects of leptin on pancreatic beta-cells. Am J Physiol Endocrinol Metab 278:E1eCE14, 2000
Seufert J: Leptin effects on pancreatic -cell gene expression and function. Diabetes 53 (Suppl. 1):S152eCS158, 2004
Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J: Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263eC1271, 1995
Rosenblum CI, Tota M, Cully D, Smith T, Collum R, Qureshi S, Hess JF, Phillips MS, Hey PJ, Vongs A, Fong TM, Xu L, Chen HY, Smith RG, Schindler C, Van der Ploeg LH: Functional STAT 1 and 3 signaling by the leptin receptor (OB-R): reduced expression of the rat fatty leptin receptor in transfected cells. Endocrinology 137:5178eC5181, 1996
Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Kim H, Lai CF, Tartaglia LA: The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci U S A 93:8374eC8378, 1996
Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM: Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632eC635, 1996
Kieffer TJ, Heller RS, Habener JF: Leptin receptors expressed on pancreatic beta-cells. Biochem Biophys Res Commun 224:522eC527, 1996
Darnell JE Jr: STATs and gene regulation. Science 277:1630eC1635, 1997
Krebs DL, Hilton DJ: SOCS: physiological suppressors of cytokine signaling. J Cell Sci 113:2813eC2819, 2000
Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS: Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619eC625, 1998
Bjorbaek C, El Haschimi K, Frantz JD, Flier JS: The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274:30059eC30065, 1999
Bjorbak C, Lavery HJ, Bates SH, Olson RK, Davis SM, Flier JS, Myers MG Jr: SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J Biol Chem 275:40649eC40657, 2000
Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura H, Torisu T, Chien KR, Yasukawa H, Yoshimura A: Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10:739eC743, 2004
Munzberg H, Flier JS, Bjorbaek C: Region-specific leptin resistance within the hypothalamus of diet-induced obese mice. Endocrinology 145:4880eC4889, 2004
Tups A, Ellis C, Moar KM, Logie TJ, Adam CL, Mercer JG, Klingenspor M: Photoperiodic regulation of leptin sensitivity in the Siberian hamster, Phodopus sungorus, is reflected in arcuate nucleus SOCS-3 (suppressor of cytokine signaling) gene expression. Endocrinology 145:1185eC1193, 2004
Ueki K, Kondo T, Tseng YH, Kahn CR: Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad Sci U S A 101:10422eC10427, 2004
Asfari M, Janjic D, Meda P, Li G, Halban PA, Wollheim CB: Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130:167eC178, 1992
Herrington J, Rui L, Luo G, Yu-Lee LY, Carter-Su C: A functional DNA binding domain is required for growth hormone-induced nuclear accumulation of Stat5B. J Biol Chem 274:5138eC5145, 1999
Seufert J, Weir GC, Habener JF: Differential expression of the insulin gene transcriptional repressor CCAAT/enhancer-binding protein beta and transactivator islet duodenum homeobox-1 in rat pancreatic beta cells during the development of diabetes mellitus. J Clin Invest 101:2528eC2539, 1998
Schreiber E, Matthias P, Muller MM, Schaffner W: Rapid detection of octamer binding proteins with ‘mini-extracts,’ prepared from a small number of cells. Nucleic Acid Res 17: 6419, 1989
Lu M, Seufert J, Habener JF: Pancreatic beta-cell-specific repression of insulin gene transcription by CCAAT/enhancer-binding protein beta: inhibitory interactions with basic helix-loop-helix transcription factor E47. J Biol Chem 272:28349eC28359, 1997
Brasier AR, Tate JE, Habener JF: Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7:1116eC1122, 1989
Bjorbaek C, Uotani S, da Silva B, Flier JS: Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272:32686eC32695, 1997
Auernhammer CJ, Bousquet C, Melmed S: Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci U S A 96:6964eC6969, 1999
Paul C, Seiliez I, Thissen JP, Le Cam A: Regulation of expression of the rat SOCS-3 gene in hepatocytes by growth hormone, interleukin-6 and glucocorticoids mRNA analysis and promoter characterization. Eur J Biochem 267:5849eC5857, 2000
Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers MG Jr: STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856eC859, 2003
Gao Q, Wolfgang MJ, Neschen S, Morino K, Horvath TL, Shulman GI, Fu XY: Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. Proc Natl Acad Sci U S A 101:4661eC4666, 2004
Galsgaard ED, Gouilleux F, Groner B, Serup P, Nielsen JH, Billestrup N: Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene. Mol Endocrinol 10:652eC660, 1996
Martens N, Uzan G, Wery M, Hooghe R, Hooghe-Peters EL, Gertler A: Suppressor of cytokine signaling 7 inhibits prolactin, growth hormone, and leptin signaling by interacting with STAT5 or STAT3 and attenuating their nuclear translocation. J Biol Chem 280:13817eC13823, 2005
Krebs DL, Hilton DJ: A new role for SOCS in insulin action: suppressor of cytokine signaling (Review). Sci STKE 2003:PE6, 2003
Ueki K, Kondo T, Kahn CR: Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24:5434eC5446, 2004
Emanuelli B, Glondu M, Filloux C, Peraldi P, Van Obberghen E: The potential role of SOCS-3 in the interleukin-1eCinduced desensitization of insulin signaling in pancreatic -cells. Diabetes 53 (Suppl. 3):S97eCS103, 2004
Howard JK, Cave BJ, Oksanen LJ, Tzameli I, Bjorbaek C, Flier JS: Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10:734eC738, 2004
Myers MG Jr: Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog Horm Res 59:287eC304, 2004(Katharina Laubner, Timoth)