Peroxisome Proliferator-Activated Receptor (PPAR) Potentiates, whereas PPAR Attenuates, Glucose-Stimulated Insulin Secretion in Pancreatic
http://www.100md.com
内分泌学杂志 2005年第8期
Kim Ravnskjaer, Michael Boergesen, Blanca Rubi, Jan K. Larsen, Tina Nielsen, Jakob Fridriksson, Pierre Maechler and Susanne Mandrup
Department of Biochemistry and Molecular Biology, University of Southern Denmark (K.R., M.B., J.K.L., T.N., J.F., S.M.), 5230 Odense M, Denmark; and Department of Cell Physiology and Metabolism, University Medical Center (B.R., P.M.), CH-1211 Geneva 4, Switzerland
Address all correspondence and requests for reprints to: Dr. Susanne Mandrup, Department of Biochemistry and Molecular Biology University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark. E-mail: s.mandrup@bmb.sdu.dk.
Abstract
Fatty acids (FAs) are known to be important regulators of insulin secretion from pancreatic ?-cells. FA-coenzyme A esters have been shown to directly stimulate the secretion process, whereas long-term exposure of ?-cells to FAs compromises glucose-stimulated insulin secretion (GSIS) by mechanisms unknown to date. It has been speculated that some of these long-term effects are mediated by members of the peroxisome proliferator-activated receptor (PPAR) family via an induction of uncoupling protein-2 (UCP2). In this study we show that adenoviral coexpression of PPAR and retinoid X receptor (RXR) in INS-1E ?-cells synergistically and in a dose- and ligand-dependent manner increases the expression of known PPAR target genes and enhances FA uptake and ?-oxidation. In contrast, ectopic expression of PPAR/RXR increases FA uptake and deposition as triacylglycerides. Although the expression of PPAR/RXR leads to the induction of UCP2 mRNA and protein, this is not accompanied by reduced hyperpolarization of the mitochondrial membrane, indicating that under these conditions, increased UCP2 expression is insufficient for dissipation of the mitochondrial proton gradient. Importantly, whereas expression of PPAR/RXR attenuates GSIS, the expression of PPAR/RXR potentiates GSIS in rat islets and INS-1E cells without affecting the mitochondrial membrane potential. These results show a strong subtype specificity of the two PPAR subtypes and on lipid partitioning and insulin secretion when systematically compared in a ?-cell context.
Introduction
PEROXISOME PROLIFERATOR-ACTIVATED receptors (PPARs) are members of the nuclear receptor superfamily and are activated by fatty acids (FAs) and FA derivatives. These transcription factors are central regulators of lipid homeostasis, and are involved in regulating insulin sensitivity and cellular growth and differentiation (1). All members of the PPAR family (PPAR, -, and -) bind to PPAR-responsive elements as heterodimers with retinoid X receptor (RXR), another member of the nuclear receptor superfamily (2). The different PPAR subtypes show very limited subtype specificity in transient transfections and in the in vitro binding to PPAR-responsive elements, but it is evident from a number of in vivo and ex vivo studies that the different PPAR subtypes do have specialized functions when acting on endogenous genes. Thus, PPAR activates primarily genes encoding proteins involved in FA oxidation during fasting (3), whereas PPAR activates genes directly involved in lipogenic pathways and insulin signaling (4). The different biological actions of PPAR subtypes are undoubtedly due in part to the differential expression patterns of the PPAR subtypes; however, there are also indications that the PPARs are biochemically different and behave differently when ectopically expressed in the same cell (5).
All members of the PPAR family have been reported to be expressed in pancreatic ?-cells (6); however, several recent reports challenge the current dogma on the functions of the different subtypes. It was recently shown that PPAR ectopically expressed in INS-1 cells could induce lipid accumulation along with a modest increase in ?-oxidation (7). Likewise, others deduce that PPAR has lipooxidative potential promoting FA disposal in pancreatic ?-cells (8). This again disagrees with the conventional lipogenic role of PPAR, but is supported by reports indicating that PPAR ligands induce delipidation of pancreatic islets (9, 10). Thus, when related to findings in other tissues, the confusion about the direct function of PPAR subtypes in pancreatic ?-cell lipid partitioning is remarkable.
FAs are known to have profound effect on the ability of ?-cells to perform glucose-stimulated insulin secretion (GSIS) (1). It is well established that FAs acutely potentiate insulin secretion by glucose and other secretagogues in a manner dependent on both chain length and degree of saturation (11, 12). This effect is mediated by increased levels of intracellular long-chain FA-coenzyme A (FA-CoA) esters (13) as well as through direct activation of the G protein-coupled receptor 40 (14). Because FA oxidation decreases cytoplasmic levels of long-chain acyl-CoA esters, conditions that increase FA oxidation have been suggested to counteract the potentiating effect of FAs on insulin secretion (15).
In contrast to the acute effects of FAs on insulin secretion, exposure of ?-cells to high levels of FAs over a longer time (>24 h) leads to elevated basal insulin secretion and compromised GSIS, a phenomenon termed lipotoxicity. The molecular mechanisms underlying lipotoxicity are unclear, but they have been suggested to involve modulation of the glucose flux (16, 17), induction of uncoupling protein-2 (UCP2) (18, 19), activation of UCP2 by increased levels of reactive oxygen species (ROS) (20, 21), and facilitation of ceramide synthesis (22, 23).
Particular attention has recently been given to the role of UCP2 in modulating GSIS. It is well established that UCP2 activity in ?-cell mitochondria and GSIS capacity are negatively correlated in certain contexts (24, 25), and evidence was recently presented that this uncoupling activity is dependent on the generation of ROS (26). However, the physiological role of UCP2 in ?-cells explaining the evolutionary conservation remains less evident from these studies. Other reports indicate that UCP2 may facilitate FA oxidation. It was found that ectopic expression of UCP2 in either the INS-1 insulinoma cell line or Zucker diabetic fatty (ZDF) rat islets significantly accelerated FA oxidation (27, 28). This may be due to increased mitochondrial recycling of FAs (29, 30) or rapid neutralization of oxygen radicals (20, 31). Interestingly, both PPAR (7, 32) and PPAR (33, 34) have been reported to induce UCP2 expression in ?-cells and other cell types.
Hence, models positioning both PPAR and - as mediators of the adverse effects of FAs on ?-cell function have been suggested (7, 34). A significant reduction in GSIS by both ectopic PPAR expression and the PPAR agonist clofibrate led to the conclusion that PPAR activity could indeed cause ?-cell dysfunction, possibly through an induction of UCP2 (7). However, these results are at odds with the generally protective and restorative effects of PPAR activation in islets experiencing increased FA challenge (6, 35, 36). A net contribution of PPAR activation to ?-cell dysfunction also disagrees with the glucolipotoxicity hypothesis describing the additive toxic effect of elevated levels of FAs and glucose on ?-cell function as the ability of glucose to repress PPAR expression and, accordingly, FA oxidation (37, 38). Similarly, the finding that PPAR agonists counteract FA toxicity on pancreatic ?-cells (10, 36, 39) does not agree with PPAR being the mediator of FA induction of UCP2 and attenuation of GSIS (34)
The inconsistent observations on the effects of PPAR and PPAR on lipid partitioning and ?-cell function prompted us to reinvestigate and directly compare the roles of these PPAR subtypes in ?-cell function. In the present work we show that acute ectopic expression of PPAR and RXR synergistically and in a PPAR subtype-specific manner increases FA uptake and oxidation capacity and induces UCP2 expression in the INS-1E rat ?-cell line. Interestingly, despite this increase in FA oxidation and UCP2 expression, transduction with PPAR/RXR potentiates GSIS of both INS-1E cells and isolated rat islets. In contrast, acute ectopic expression of PPAR and RXR does not affect FA oxidation, but induces massive accumulation of triglycerides and impairs GSIS. These results confirm the roles of PPAR as a catabolic and PPAR as a lipogenic transcription factor also when ectopically expressed in pancreatic ?-cells. Importantly, our results show that acute activation of PPAR potentiates, whereas acute activation of PPAR compromises, GSIS.
Materials and Methods
Cell culture
The cell line INS-1E was cultured as previously described (40). The cells in use were all at passage numbers between 50 and 70 and were used for experiments at 70–80% confluence. All media and supplements were obtained from Invitrogen Life Technologies, Inc. (Carlsbad, CA), and serum was purchased from HyClone (Logan, UT). Rat islets were isolated using collagenase digestion and cultured 24 h before experiments in RPMI 1640 supplemented as described (40).
Adenovirus generation and transduction
Recombinant adenoviruses containing full-length mouse PPAR, PPAR2, and RXR were generated using the AdEasy cloning system from Stratagene (La Jolla, CA). The three genes were initially cloned into pShuttle-CMV using SalI and EcoRV restriction sites and were moved to AdEasy-1 by homologous recombination. The linearized plasmids were transfected into 293-HEK cells, and the virus was amplified and purified using CsCl gradients. Viruses were initially titrated, and titers were estimated by a plaque assay-based approach. Subsequently, relative titers of functional viruses were equalized based on quantification of the adenoviral transcript AdE4 by real-time PCR. Relative titers 1, 2, 5, and 25 correspond to 4, 8, 20, and 100 plaque-forming units/cell respectively.
After medium removal, cells were washed once in PBS and transduced for 90 min in RPMI 1640 supplemented as described above. Viruses were removed, and new medium containing specific agonists was added for an additional 24- or 48-h incubation. In all experiments, equal total amounts of AdVector were used as a control, and dimethylsulfoxide (DMSO) was added to the incubation medium. All experiments for RNA and protein extraction were performed in duplicate.
[1-14C]Oleate uptake
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were washed twice in Hanks’ buffered salt solution (HBSS) and incubated for 30 min in HBSS and 10 μM oleate (3 nCi/ml [1-14C]oleate; Pharmacia Biotech, Uppsala, Sweden). Oleate uptake was stopped by the addition of ice-cold stop solution (HBSS and 2% BSA), and cells were washed three times herein and once in ice-cold PBS. The 14C content was quantified and normalized to total DNA per well. Dishes without cells were treated in parallel, and values were used for background subtraction. Experiments were performed in triplicate.
[1-14C]Oleate oxidation
Oleate oxidation over 4 h of transduced INS-1E cells (relative titer, 1, 2, 5, and 25; 24-h incubation) was measured by quantification of collected 14CO2 essentially as described by Berge et al. (41). Data were normalized to total cellular protein. Dishes without cells were treated in parallel and used for background subtraction. Experiments were performed in triplicate.
[1-14C]Glucose oxidation
Glucose oxidation of transduced INS-1E cells (relative titer, 5) was measured by quantification of 14CO2 produced from oxidation of [1-14C]glucose. Cells were harvested in supplemented RPMI 1640 with 5 mM glucose and collected in sealed glass tubes. Glucose was raised to 16.7 mM (0.4 μCi [1-14C]glucose/tube), and cells were incubated for 30 min at 37 C. Collection, quantification, and normalization of 14CO2 were performed as described above (40). Experiments were performed in triplicate.
Lipid accumulation assay
INS-1E cells were seeded on Falcon chamber slides (BD Biosciences, Franklin Lakes, NJ), transduced with viruses (relative titer, 2), and incubated for 48 h with DMSO or specific agonists as described. Cells were fixed in ice-cold PBS/4% paraformaldehyde, washed in 70% ethanol, and stained with Nile Red (1 ng/μl; Sigma-Aldrich Corp., St. Louis, MO). Stained cells were washed three times in ice-cold 70% ethanol. Lipid accumulation was visualized by confocal laser scanning microscopy (excitation, 543 nm) using the LSM 510 Meta confocal microscope (Carl Zeiss, Inc., New York, NY).
Protein analysis by Western blotting and ECL detection
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were harvested in hypotonic lysis buffer containing sodium dodecyl sulfate and separated by SDS-PAGE. Proteins were blotted onto polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA) and probed with specific antibodies. All primary antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA): anti-PPAR (SC-7273), anti-RXR (SC-553), antitranscription factor-IIB (anti-TFIIB; SC-225), and anti-UCP2 (SC-20). Secondary horseradish peroxidase-coupled anti-Fc antibodies, antimouse (P0447) and antirabbit (P0399), were obtained from DakoCytomation (Carpinteria, CA).
RNA isolation and cDNA synthesis
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were harvested in guanidium thiocyanate, and RNA was isolated according to a modified Chomczynski-Sacchi protocol (42). cDNA was prepared after deoxyribonuclease I treatment (Invitrogen Life Technologies, Inc.) by RT (Invitrogen Life Technologies, Inc., First-Strand Kit) of the isolated RNA primed by random hexamers (dexoy-NTP6).
Real-time PCR
Quantitative three-step real-time PCR was performed on the ABI-7700 PRISM real-time PCR instrument (Applied Biosystems, Foster City, CA) using 2x SYBR Green Master Mix (Sigma-Aldrich Corp.) and Sigma passive reference according to instructions from the manufacturer. PCRs were performed in duplicate. Primers for real-time PCR were designed using Primer Express 2.0 (Applied Biosystems), and specificity and efficacy were validated before use. All quantifications were performed with TFIIB as the internal standard and are presented as the fold increase over the control value.
Primer sequences (forward and reverse, respectively) are as follows: RXR, CCTGCCGAGACAACAAGGA and ACCGGTTCCGCTGTCTCTT; PPAR, GTACCACTACGGAGTTCACGCAT and CGCCGAAAGAAGCCCTTAC; PPAR, CACAATGCCATCAGGTTTGG and CAGCTTCTCCTTCTCGGCCT; carnitine palmitoyl transferase-1a (CPT-1a), CTGGTGGGCCACAAATTACG and AGGTAGATATATTCTTCCCACCAGTCA; CPT-1b, TCCAAACATCACTGCCCAAG and GAATTGTGGCTGGCACACTG; UCP2, CCTACAGCGCCAGATGAGCT and GAGTCGTAGAGGCCAATGCG; medium-chain acyl-CoA dehydrogenase (MCAD), AGCTGCTAGTGGAGCACCAAG and TCGCCATTTCTGCGAGC; long-chain acyl-CoA dehydrogenase (LCAD), TCACCAATCGTGAAGCTCGA and CCAAAAAGAGGCTAATGCCATG; acyl-coenzyme A oxidase (ACO), CAGATAATTGGCACCTACGCC and AAGATGAGTTCCGTGGCCC; fatty acid transport protein-1 (FATP1), GTGTACCCCATCCGTCTGGT and CAGTGGCTCCATCGTGTCCT; FATP2, TGGACGCGATCATCTCTGG and TGTGGCGAAGGTTTCAAGGT; catalase, CGTGGGAAACAACACCCCTA and GGAAACAACATGGCATCCCT; perilipin, GGGACCTGTGAGTGCTTCCA and GTGGGCTTCTTTGGTGCTGT; pyruvate dehydrogenase kinase-4 (PDK4), CACGCTGGTCAAAGTTCGAA and GCCATCGTAGGGACCACATT; CD36, TTCTGCTGCACGAGGAGGA and AATGAGCCCACAGTTCCGAT; TFIIB, GTTCTGCTCCAACCTTTGCCT and TGTGTAGCTGCCATCTGCACTT; and AdE4, CTCCGGAACCACCACAGAAA and GCAGACATGTTTGAGAGAAAAATGG.
Mitochondrial membrane potential (m)
The m of transduced INS-1E cells (relative titer, 5; 24-h incubation) was measured using the fluorescent probe, rhodamine 123 (Molecular Probes, Eugene, OR) as described previously (40). Cells were maintained for 2 h in 2.5 mM glucose medium at 37 C before loading with 10 μg/ml rhodamine 123 for 20 min at 37 C in Krebs ringer bicarbonate HEPES. The m was monitored with excitation and emission filters set at 485 and 520 nm, respectively. Glucose (additions on top of basal, 2.5 mM), and then the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone was added to each well.
Insulin secretion
Insulin secretion from transduced INS-1E cells and rat islets (relative titer, 5; 24-h incubation) over a period of 30 min was measured by RIA using rat insulin as standard as previously described (40), and values were normalized to total insulin content.
Statistical analysis
Statistical evaluation of the data was performed using Student’s two-tailed t test on paired data. Data (fold increase over control value) are presented as the mean ± SD (n 3) or the mean ± range (n = 2).
Results
Synergy between adenovirally expressed PPAR and RXR in the INS-1E ?-cell line
It is well documented that both pancreatic islets from rodents and ?-cell-derived insulinoma cells express functional PPAR (6, 37). To investigate the acute effect of increased PPAR activity on target gene expression in pancreatic ?-cells, we transduced INS-1E cells with adenoviral vectors expressing PPAR. To investigate whether the endogenous level of RXR would become limiting for gene activation, we cotransduced with adenoviral vectors expressing RXR. INS-1E cells were transduced with the indicated viruses and cultured for 24 h with DMSO, the PPAR agonist WY14643, and/or the RXR agonist LG100268 as indicated. AdVector was used as a control. The viruses were all used with the relative titer 2 based on Ad4E expression (see Materials and Methods). Real-time PCR was used to quantify expression levels of the two classical PPAR target genes, CPT-1b and ACO (Fig. 1), which are rate-limiting for mitochondrial and peroxisomal FA oxidations, respectively. The expression of both genes was significantly induced by the specific agonists (P < 0.05–0.01) activating endogenous PPAR and RXR, and this induction was further potentiated by ectopic expression of the nuclear receptors. Interestingly, coexpression of AdPPAR and AdRXR synergistically increased the expression of the target genes in both the absence and the presence of exogenous ligands. Transactivation of the two target genes by PPAR/RXR in the absence of exogenous ligands indicates that either this transactivation is ligand independent, or significant levels of endogenous ligands are present in the INS-1E cells. However, the addition of receptor-specific, high affinity exogenous ligands potentiates the transaction of target genes by AdPPAR/AdRXR to levels 5- and 6-fold above basal levels (P < 0.002). The synergy between AdPPAR and AdRXR reveals that the endogenous level of RXR is not sufficient to fully support transcriptional activation by ectopically expressed PPAR, and that sequestration of RXR from other nuclear receptors could be an undesirable side effect of overexpressing PPAR alone. Thus, we chose to coexpress RXR with PPAR in subsequent experiments.
FIG. 1. PPAR and RXR synergistically activate the expression of target genes in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), RXR (R), or the empty adenoviral vector virus [AdVector (C)], as indicated at relative titer 2 (see Materials and Methods). Cells were subsequently cultured for 24 h with DMSO or the agonists WY14643 (30 μM) and LG100268 (200 nM) as indicated. The expression of CPT-1 and ACO was determined by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. Means not sharing the same superscript differ significantly (P < 0.05). The results presented are representative of at least three independent experiments.
Dose- and subtype-dependent effects of adenovirally expressed PPAR or PPAR together with RXR in INS-1E cells
To determine whether the effects on gene expression were specific for the PPAR subtype, we transduced INS-1E cells with increasing titers of adenoviruses expressing either PPAR or PPAR in combination with AdRXR. To ensure comparable virus titers, we performed both plaque assays and routinely monitored the expression of the adenoviral E4 transcript (AdE4). After transduction, INS-1E cells were cultured 24 h with DMSO or the specific agonist, WY14643 or BRL49653 together with LG100268. Quantitative real-time PCR was used to quantify the ectopic expression levels of the PPARs and RXR (Fig. 2A). Protein expression was determined by Western blotting (Fig. 2B). At the level of both mRNA and protein, ectopically expressed PPAR and PPAR were equally abundant. Also, RXR levels were comparable in the two sets of samples. Even very low doses of ectopically expressed PPAR or PPAR together with RXR produced a significant and highly subtype-specific response at the level of target gene expression. The expressions of ACO and perilipin were dose- and subtype-dependently increased by AdPPAR and AdPPAR transduction, respectively (P < 0.05–0.02; Fig. 2C). Only a modest effect of AdPPAR was seen on ACO expression levels, whereas AdPPAR had no effect on perilipin expression. Adenoviral expression of PPAR is, therefore, a valuable control for PPAR-specific effects in INS-1E cells and vice versa.
FIG. 2. Dose- and subtype-dependent effects of adenoviral expression of PPAR and - in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (or 25, protein only) and cultured 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). AdVector (C) was given, corresponding to a relative titer of 10 (or 50, protein). A and C, mRNA levels of AdPPAR, AdPPAR, and AdRXR as well as endogenous ACO and perilipin were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, Whole cell protein was extracted and separated by SDS-PAGE, and levels of AdPPAR, AdRXR, and TFIIB were determined by immunoblotting. *, P < 0.05; , P < 0.02 (significantly different from AdVector). All results presented are representative of at least three independent experiments.
FA uptake in INS-1E cells adenovirally transduced with PPAR or PPAR together with RXR
To study the metabolic effects of AdPPAR and - expression in ?-cells, INS-1E cells were transduced with the indicated viruses using relative titers 1, 2, and 5 and were subsequently cultured 24 h with DMSO or the specific agonist, WY14643 or BRL49653 together with LG100268. Total RNA was isolated, and expression levels of the FA transporters CD36, FATP1, and FATP2 were quantified by real-time PCR (Fig. 3A). Both AdPPAR and AdPPAR increased CD36 expression dramatically, whereas FATP1 expression was increased mainly by AdPPAR, and FATP2 was increased mainly by AdPPAR. FA uptake was measured by incubating the transduced cells with 14C-labeled oleate and subsequently quantifying the 14C content. In keeping with the increased expression of genes encoding FA transporters, both AdPPAR and AdPPAR increased FA uptake in the cells in a dose-dependent manner up to 2-fold (P < 0.05–0.001; Fig. 3B).
FIG. 3. Fatty acid transport is stimulated by adenoviral PPAR expression in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at the relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, mRNA levels of the FA transporters FATP1, FATP2, and CD36 were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, [1-14C]Oleate uptake over 30 min was measured in triplicate, normalized to total cellular DNA, and presented as the fold increase over the control (C) value. The SD is indicated. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02; , P < 0.01; #, P < 0.005; , P < 0.002; ||, P < 0.001). The results presented are representative for at least three independent experiments.
Subtype-specific effects of adenovirally expressed PPAR together with RXR on FA oxidation genes in INS-1E cells
To investigate the impact of PPAR on the metabolism of FAs taken up by the ?-cell, the expression levels of genes associated with FA oxidation was determined (Figs. 4 and 2C). All genes presented, PDK4, catalase, liver and muscle forms of CPT-1 (CPT-1a and -b), MCAD, LCAD, and ACO, were dose-dependently up-regulated by AdPPAR (P < 0.05–0.001), whereas AdPPAR only modestly affected expression levels. Thus, ectopic expression of PPAR/RXR in INS-1E cells induces genes involved in both mitochondrial and peroxisomal FA oxidation in a PPAR subtype-specific manner. Neither the expression of cytochrome c nor that of nuclear respiratory factor-1 was affected by AdPPAR (data not shown), indicating that mitochondrial biogenesis was not stimulated by PPAR in this system.
FIG. 4. FA oxidation genes are specifically induced by PPAR in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). The mRNA levels for genes involved in FA oxidation PDK4, catalase, CPT-1a, CPT-1b, MCAD, and LCAD were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02; , P < 0.01; #, P < 0.005; ||, P < 0.001). The results presented are representative of at least three independent experiments.
FA and glucose oxidation in INS-1E cells adenovirally transduced with PPAR/RXR or PPAR/RXR
With increased FA uptake and induction of key factors in FA oxidation, PPAR would be expected to increase the FA oxidation capacity of the ?-cell. To address this, INS-1E cells were transduced with the indicated viruses and respective ligands. Mitochondrial ?-oxidation was determined in the presence or absence of etomoxir, an inhibitor of CPT-1 activity (Fig. 5A). AdPPAR/AdRXR dose-dependently increased oleate oxidation 4- to 12-fold (P < 0.05–0.02) in a manner completely blocked by etomoxir. In contrast, AdPPAR/AdRXR had no effect on ?-cell FA oxidation capacity, clearly demonstrating that increased ?-oxidation is a PPAR-specific effect. Oleate oxidation was also increased 2-fold (P < 0.05) by activation of endogenous PPAR with WY14643 (Fig. 5B) and was synergistically potentiated by concomitant RXR activation (5-fold; P < 0.005). By contrast, glucose oxidation was unaffected by ectopic expression of either PPAR subtype together with RXR (Fig. 5C).
FIG. 5. Oxidation of oleate, but not glucose, is stimulated by PPAR in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, [1-14C]Oleate oxidation over 4 h was measured in triplicate, normalized to total cellular protein, and presented as the fold increase over the control (C) value (25E, 50 μM etomoxir added before ?-oxidation). B, [1-14C]Oleate oxidation over 4 h in nontransduced INS-1E cells treated 24 h with WY14643 and/or LG100268. C, [1-14C]Glucose oxidation over 30 min was measured in triplicate, normalized to total cellular protein, and presented as the fold increase over the control (C) value. The SD is indicated. Means significantly different from the control are indicated (*, P < 0.05; , P < 0.02; #, P < 0.005). The results presented are representative of at least three independent experiments.
Lipid accumulation in INS-1E cells adenovirally transduced with PPAR or PPAR alone or together with RXR
Because AdPPAR/AdRXR increased FA uptake, but not oxidation, an increased storage of FAs as triacylglycerides would be expected. To investigate this, INS-1E cells were fixed and stained with the lipophilic fluorescent dye, Nile Red, 48 h after transduction with the respective viruses (relative titer, 2; Fig. 6). No lipid accumulation was seen in the cells transduced with AdVector, AdPPAR, or AdPPAR/AdRXR. In contrast, comparable expression of AdPPAR facilitated massive accumulation of lipid droplets forming ring-like structures in the cytoplasm. This accumulation was potentiated by PPAR activation by the agonist BRL49653or by cotransduction with AdRXR. Neither of the ligands alone or in combination induced lipid accumulation (data not shown). Hence, ectopically expressed PPAR and PPAR subtypes specifically drive FAs taken up by the pancreatic ?-cell along two opposite pathways, leading to FA oxidation and accumulation as neutral lipids, respectively.
FIG. 6. PPAR facilitates lipid accumulation in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR, PPAR, RXR, or AdVector as indicated at a relative titer of 2. Cells were subsequently cultured for 48 h with DMSO or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). Nile Red staining and confocal fluorescence microscopy visualized triglyceride accumulation. The results presented are representative of at least three independent experiments.
UCP2 levels and m in INS-1E cells transduced with PPAR or PPAR together with RXRa
Previous studies have indicated a linkage between the UCP2 expression level and PPAR activity. We therefore investigated whether ectopic expression of PPAR/RXR would also increase UCP2 levels in this system. As shown in Fig. 7, A and B, AdPPAR/AdRXR markedly increased both the gene expression (P < 0.05–0.02) and the protein level of UCP2 in a receptor dose-dependent manner. Similar to other PPAR target genes (Fig. 1), UCP2 expression was significantly induced by exogenous ligands without ectopically expressed receptors and by coexpression of AdPPAR/AdRXR in the absence of exogenous ligands (data not shown). In contrast, transduction with AdPPAR/AdRXR resulted in a lower and dose-independent induction of UCP2 expression. The induction of UCP2 by PPAR was independent of FA oxidation, because etomoxir slightly potentiated, rather than blocked, the induction.
FIG. 7. PPAR increases UCP2 levels in INS-1E cells, but does not affect m. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at the relative titers of 1, 2, and 5 (or 25, protein only). AdVector was given, corresponding to a relative titer of 10 (or 50, protein). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, UCP2 mRNA was quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, Whole cell protein was extracted and separated by SDS-PAGE, and levels of UCP2 and TFIIB were estimated by immunoblotting and determined by densiometric scanning. C, m was measured using rhodamine 123. Where indicated, glucose was increased to 15 mM. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02). All results presented are representative of at least three independent experiments.
To investigate whether the PPAR/RXR-induced increase in FA oxidation capacity and/or the increased UCP2 levels would affect the basal mitochondrial potential or the glucose-induced hyperpolarization of the mitochondrial membrane, the m was measured. INS-1E cells were transduced with AdPPAR/AdRXR or AdVector at a relative titer of 5 and were incubated 24 h with DMSO or the specific agonists. Cells were subsequently loaded with rhodamine-123 and incubated at low glucose (2.5 mM) before stimulation with 15 mM glucose as indicated (Fig. 7C). Despite increased UCP2 levels, AdPPAR/AdRXR affected neither basal m nor glucose-induced mitochondrial membrane hyperpolarization. In both the absence and the presence of ectopically expressed receptors, ligands slightly blunted the glucose-induced mitochondrial membrane hyperpolarization. This effect may be ascribed to a direct, PPAR-independent effect on the mitochondrial membrane during the 24-h incubation as reported by others (21, 43).
GSIS from INS-1E cells and rat islets adenovirally transduced with PPAR or PPAR together with RXR
The above results clearly demonstrate that ectopic AdPPAR/AdRXR expression increases FA uptake and oxidation and results in up-regulation of UCP2 expression without affecting m, whereas AdPPAR/AdRXR expression results in FA uptake and lipid accumulation. To investigate the overall effect on ?-cell GSIS, we transduced INS-1E cells with either AdPPAR/AdRXR or AdVector and cultured 24 h with DMSO (control) or the respective agonists. Insulin secretion was measured over a 30-min period of stimulation. AdPPAR/AdRXR significantly potentiated GSIS (+54%; P < 0.02), whereas basal insulin secretion was unaffected (Fig. 8A). In clear contrast, AdPPAR/AdRXR markedly impaired GSIS (–65%; P < 0.01) implicating subtype-specific effects of PPAR and PPAR on GSIS (Fig. 8B). Blocking FA oxidation with etomoxir did not compromise the potentiating effect of PPAR (Fig. 8C), suggesting that the potentiation of GSIS is caused by mechanisms other than increased ATP generation from FA oxidation. The cellular insulin content was not affected by the treatments (data not shown). In keeping with the effects of the ligands on m (Fig. 7B), the ligands caused a decrease in GSIS (data not shown), and ligands slightly decreased, rather than potentiated, the effect of PPAR/RXR on GSIS (Fig. 8A).
FIG. 8. PPAR potentiates GSIS in INS-1E cells and rat islets. INS-1E cells and rat islets were adenovirally transduced with PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at a relative titer of 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). Insulin secretion over 30 min in INS-1E cells (A–C) and rat islets (D) was quantified by RIA and normalized to total insulin content. C, GSIS was performed after 30-min preincubation in the presence of DMSO or 50 μM etomoxir (Etom). A–C: , 2.5 mM glucose; , 15 mM glucose. C: , 2.8 mM glucose; , 16.7 mM glucose. *, P < 0.02 vs. low glucose. The results presented are representative of at least two independent experiments.
Finally, we wanted to investigate whether AdPPAR/AdRXR would also potentiate GSIS in primary ?-cells. We therefore transduced isolated rat islets with AdPPAR/AdRXR or AdVector and cultured for 24 h. As shown in Fig. 8D, AdPPAR/ AdRXR specifically potentiated GSIS (+48%; P < 0.005) in primary rat ?-cells. In conclusion, ectopic expression of PPAR together with its heterodimerization partner, RXR, potentiated GSIS from both clonal INS-1E ?-cells and rat islets despite increased UCP2 levels and unaffected mitochondrial energy generation. In contrast, ectopic expression of PPAR and RXR significantly decreased GSIS.
Discussion
The role of PPARs in ?-cell physiology has been the focus of intense investigation. It is well known that all three PPAR subtypes are expressed in both islets and insulinoma cells, but their levels may vary considerably in response to other stimuli. A central role of PPAR in leptin signaling and functional restoration of islets from diabetic ZDF rats was pointed out by Unger’s group (6, 44) and later confirmed in a whole-body analysis comparing wild-type and PPAR-null animals (45). The abnormal FA metabolism and defects in insulin secretion of ZDF rat islets could partly be ascribed to subnormal levels of PPAR. This linkage between PPAR expression and normal ?-cell function was also supported by studies of islets exposed to hyperglycemic conditions (37, 38). In these studies it was shown that high glucose levels significantly repressed PPAR expression and FA oxidation, and it was suggested that this effect of glucose would be central to the concept of glucolipotoxicity.
Also administration of PPAR agonists has been reported to be beneficial for ?-cell function under conditions with lipid excess. Both in human and murine islets, thiazolidinedione compounds known as potent PPAR agonists have been shown to neutralize the adverse effects of FAs on ?-cell function (10, 36, 39). Whether these effect are mediated by PPAR dependent mechanisms is currently not known. However, in other studies ectopic expression of PPAR and acute administration of thiazolidinedione compounds to normal islets unexpectedly increased islet lipid oxidation and attenuated the GSIS (8). Moreover, counteracting PPAR function by chronic administration of a PPAR antagonist totally attenuates FA induction of UCP2 and restored GSIS (34), suggesting that PPAR mediates, rather than protects against, FA toxicity within the time frame of investigation.
Recently, the beneficial physiological effects of PPAR activity on islet cell function were questioned (7). Upon adenoviral transduction of INS-1 insulinoma cells with PPAR or treatment with high doses of the hypolipidemic drug clofibric acid, a suppression of basal and glucose-stimulated insulin secretion was seen. This impairment of ?-cell function was hypothesized to be caused by increased proton leakage from mitochondria due to elevated levels of UCP2, by depletion of cytosolic free FA pools due to increased FA oxidation, or by mitochondrial desensitization. Studies of islets isolated form PPAR knockout mice are ambiguous. Some investigators reported an unaltered glucose response in PPAR–/– islets (46), whereas others found that cultured islets from fasted PPAR–/– mice hypersecrete insulin over a broad range of glucose concentrations compared with islets from wild-type mice (47).
The conflicting reports on the roles of PPAR and - in ?-cells prompted us to reinvestigate the effects of these nuclear receptors on ?-cells by acutely and ectopically expressing either of the PPAR subtypes in balance with their common heterodimerization partner RXR in the highly differentiated rat ?-cell line INS-1E and in rat islets. In experiments using more long-term or chronic activation (or deactivation) of the PPARs, it is difficult to distinguish between primary and secondary effects of the PPAR subtypes. By contrast, the strategy employed in this study, i.e. acute ectopic expression of the PPARs by adenoviral vectors, allowed us to determine the direct effects of elevated PPAR or - activity in pancreatic ?-cells. In this first parallel analysis of the potencies of the PPAR and - subtypes, each subtype served as a valuable control for the specificity of the effects the other subtype. In addition, to determine whether endogenous PPARs play a role similar to that suggested by ectopic expression, we investigated the effects of acute treatment with PPAR ligands on ?-cell gene expression and function.
The synergy between PPAR and RXR revealed that the endogenous level of RXR is insufficient to fully support transcriptional activation by ectopically expressed PPAR. Sequestration of endogenous RXR from its other dimerization partners could therefore be an undesirable side effect of overexpressing the PPARs alone. Thus, RXR was coexpressed in subsequent experiments. We showed that coexpression of PPAR and RXR led to significant induction of target gene expression even in the absence of exogenous ligands. This finding indicates that either considerable amounts of endogenous ligands are present in INS-1E cells or these receptors are able to activate endogenous target genes in the absence of ligands.
We found that both PPAR and PPAR dose-dependently increased the FA uptake of INS-1E cells. However, the two PPARs directed the incoming FAs along different metabolic pathways. Whereas both activation of the endogenous PPAR and ectopically expressed PPAR induced ?-oxidation of the FAs, ectopic expression of PPAR facilitated lipid accumulation in the ?-cell. This subtype specificity in lipid partitioning was reflected in the strict subtype-specific induction of target genes, which is conserved even when the PPARs are ectopically expressed. This finding is important for the interpretation of our data, because it indicates that the specific effects elicited by the ectopically expressed PPARs to a very large extent reflect the potencies of endogenous PPARs. A change in the relative levels of the PPAR subtypes thus is acutely translated into different metabolic profiles of the ?-cell. Under normal physiological conditions, ?-cell expression of PPAR exceeds that of PPAR (6, 38). This is in line with our present findings that endogenous PPAR levels are sufficient to stimulate target gene expression and FA oxidation, whereas agonist activation of the endogenous PPAR affects neither target genes (results not shown) nor lipid accumulation (Fig. 6). It can be speculated that under hyperglycemic or hyperlipidemic conditions, the picture would change, mimicked by PPAR overexpression, and lipid accumulation would be facilitated.
In agreement with previous reports (7, 32), PPAR induced UCP2 expression. This increase was a direct effect of PPAR, rather than secondary to the increased FA oxidation, and was also reflected in increased UCP2 protein levels. Interestingly, neither basal m nor glucose-induced mitochondrial hyperpolarization was affected by increased PPAR activity and the resulting UCP2 induction. Thus, the moderate induction of UCP2 per se appeared not to uncouple the mitochondrial membrane. On the contrary, ligands of PPAR, PPAR, and RXR partially compromised the glucose-induced hyperpolarization of the mitochondrial membrane in a receptor-independent manner. This observation is probably due to the effects of these lipophilic compounds on mitochondrial respiratory chain function, as has been reported by others (21, 43).
Importantly, GSIS was significantly potentiated by PPAR/RXR expression in both INS-1E cells and rat islets despite the ability of PPAR/RXR to increase UCP2 levels. PPAR/RXR, in contrast, only increased UCP2 mRNA levels 1.5- to 2-fold, but severely reduced both basal insulin secretion and GSIS by approximately 55%. To understand the discrepancy between UCP2 induction and effects on insulin secretion, the activity of UCP2 should be considered. In recent reports, superoxide was pointed out as the endogenous activator of UCP2 uncoupling activity (21, 26) in a potentially protective feedback loop. It is also well known that ROS production is induced not only by mitochondrial oxidation processes through reduction of respiratory complex I (21), but also by complex lipids, such as ceramide, in various cell types (48, 49, 50). In ?-cells, ceramide generation is part of the lipotoxic/cytotoxic effect associated with exposure to saturated FAs and deposition of these rather than oxidation (22, 51, 52, 53). Thus, PPAR expression might increase ROS production through increased lipid uptake in cells not metabolically adjusted to handle this challenge. In contrast, PPAR turns on a complete program of lipid uptake, lipid oxidation, neutralization of ROS, and adaptation of the citric acid cycle. This potentially equilibrates the FA flux at a higher level without increasing ROS generation or compromising the discrete compliant pools of FAs in the cytoplasm predicted to contribute to the full insulin response (13, 54, 55).
Another important aspect in understanding the observed differences between the two PPAR subtypes on GSIS may be the PPAR-stimulated PDK4 expression and expected augmented anaplerotic flow into the citric acid cycle. Anaplerosis is critical to the insulin response, and inhibition of pyruvate dehydrogenase by PDK4 could sensitize the ?-cell to glucose (56, 57), potentially through increased formation of mitochondrial coupling factors (58, 59). Such a mechanism would be in agreement with the observed potentiation of GSIS in this study and our finding that elimination of the ATP contribution from FA oxidation during GSIS did not interfere with the positive effect of PPAR. In a recent review, Sugden and Holness (60) proposed a concept, for PPAR action on insulin secretion, also consistent with our present observations. Hence, increased PPAR activity could play a role in liporegulation through improved ?-cell function and compensatory insulin secretion in the hyperlipidemic state in vivo. The recent suggestion that PPAR activation by FAs is responsible for ?-cell adaptation to fasting conditions by reducing the pool of cytoplasmatic acyl-CoA esters critical for GSIS (47) is an interesting proposal and does not directly conflict with the present gain of function data. Our results show that acute activation of PPAR has a net potentiating effect on GSIS, but do not exclude that PPAR under some conditions could promote exhaustion of the cytoplasmic acyl-CoA pool and blunt GSIS. However, under our conditions this is either not rate limiting or is counteracted by other positive effects of PPAR.
The finding that acute ectopic expression of PPAR causes massive triglyceride accumulation in INS-1E cells is in keeping with the current view that PPAR is a lipogenic transcription factor. However, this observation is at odds with the findings of Parton et al. (8), who showed that ectopic expression of PPAR increases FA oxidation and decreases lipid accumulation in rat islets. It is possible that these discrepancies are due to differences in ectopic expression levels, the duration of the experiment (24 vs. 48 h), or the fact that Parton et al. (8) ectopically expressed PPAR1, whereas we expressed PPAR2. However, to date, significant functional differences between PPAR isoforms 1 and 2 have not been described. In our system, glucose oxidation was not significantly affected, and it appears more likely that the PPAR-induced attenuation of GSIS is due to the massive lipid accumulation and increased ceramide synthesis reported to result from such accumulation. However, in the chronic hyperlipidemic state, PPAR could be important for compensatory ?-cell hyperplasia, as suggested by islet studies of ?-cell-specific PPAR knockout mice (61).
In conclusion, a significant subtype specificity is observed when comparing PPAR and PPAR in pancreatic ?-cells. Acute ectopic expression of PPAR/RXR increases the FA oxidation capacity in INS-1E cells and results in a net potentiation of GSIS in both INS-1E cells and primary rat islets. The increased expression of UCP2 protein does not per se ablate glucose-stimulated hyperpolarization of the mitochondrial membrane, an observation in agreement with the idea that uncoupling by UCP2 requires activation by reactive oxygen species. The exact molecular mechanisms underlying the potentiation of GSIS by PPAR are unclear at this point, but may involve enhanced anaplerotic feeding of the citric acid cycle and generation of mitochondrial coupling factors. This would be in keeping with the activation of PDK4 expression by PPAR and the observation that the potentiation of GSIS is not dependent on ongoing FA oxidation or accompanied by an increase in m. In contrast, acute ectopic expression of PPAR/RXR increases triglyceride accumulation and leads to attenuation of GSIS. Of note, agonist activation of endogenous PPAR, but not PPAR, affects gene expression and lipid metabolism similarly to ectopic expression of the nuclear receptor. Hence, under the present normoglycemic and normolipidemic conditions, PPAR appears to be the functionally more important subtype.
Acknowledgments
We are grateful to Claes Wollheim for supplying the INS-1E cell line.
References
Ferre P 2004 The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 53(Suppl 1):S43–S50
Gearing KL, Gottlicher M, Teboul M, Widmark E, Gustafsson JA 1993 Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci USA 90:1440–1444
Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W 1999 Peroxisome proliferator-activated receptor mediates the adaptive response to fasting. J Clin Invest 103:1489–1498
Mueller E, Drori S, Aiyer A, Yie J, Sarraf P, Chen H, Hauser S, Rosen ED, Ge K, Roeder RG, Spiegelman BM 2002 Genetic analysis of adipogenesis through peroxisome proliferator-activated receptor isoforms. J Biol Chem 277:41925–41930
Brun RP, Tontonoz P, Forman BM, Ellis R, Chen J, Evans RM, Spiegelman BM 1996 Differential activation of adipogenesis by multiple PPAR isoforms. Genes Dev 10:974–984
Zhou YT, Shimabukuro M, Wang MY, Lee Y, Higa M, Milburn JL, Newgard CB, Unger RH 1998 Role of peroxisome proliferator-activated receptor in disease of pancreatic ? cells. Proc Natl Acad Sci USA 95:8898–8903
Tordjman K, Standley KN, Bernal-Mizrachi C, Leone TC, Coleman T, Kelly DP, Semenkovich CF 2002 PPAR suppresses insulin secretion and induces UCP2 in insulinoma cells. J Lipid Res 43:936–943
Parton LE, Diraison F, Neill SE, Ghosh SK, Rubino MA, Bisi JE, Briscoe CP, Rutter GA 2004 Impact of PPAR overexpression and activation on pancreatic islet gene expression profile analyzed with oligonucleotide microarrays. Am J Physiol 287:E390–E404
Higa M, Zhou YT, Ravazzola M, Baetens D, Orci L, Unger RH 1999 Troglitazone prevents mitochondrial alterations, ? cell destruction, and diabetes in obese prediabetic rats. Proc Natl Acad Sci USA 96:11513–11518
Shimabukuro M, Zhou YT, Lee Y, Unger RH 1998 Troglitazone lowers islet fat and restores ? cell function of Zucker diabetic fatty rats. J Biol Chem 273:3547–3550
Dobbins RL, Chester MW, Stevenson BE, Daniels MB, Stein DT, McGarry JD 1998 A fatty acid-dependent step is critically important for both glucose- and non-glucose-stimulated insulin secretion. J Clin Invest 101:2370–2376
Stein DT, Stevenson BE, Chester MW, Basit M, Daniels MB, Turley SD, McGarry JD 1997 The insulinotropic potency of fatty acids is influenced profoundly by their chain length and degree of saturation. J Clin Invest 100:398–403
Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V, Przybykowski E, Morin J, Masse F, Massie B, Ruderman N, Rhodes C, Poitout V, Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli. Diabetes 53:1007–1019
Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S, Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S, Fujisawa Y, Fujino M 2003 Free fatty acids regulate insulin secretion from pancreatic ? cells through GPR40. Nature 422:173–176
Rubi B, Antinozzi PA, Herrero L, Ishihara H, Asins G, Serra D, Wollheim CB, Maechler P, Hegardt FG 2002 Adenovirus-mediated overexpression of liver carnitine palmitoyltransferase I in INS1E cells: effects on cell metabolism and insulin secretion. Biochem J 364:219–226
Hosokawa H, Corkey BE, Leahy JL 1997 ?-Cell hypersensitivity to glucose following 24-h exposure of rat islets to fatty acids. Diabetologia 40:392–397
Yoshikawa H, Tajiri Y, Sako Y, Hashimoto T, Umeda F, Nawata H 2001 Effects of free fatty acids on ?-cell functions: a possible involvement of peroxisome proliferator-activated receptors or pancreatic/duodenal homeobox. Metabolism 50:613–618
Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272
Lameloise N, Muzzin P, Prentki M, Assimacopoulos-Jeannet F 2001 Uncoupling protein 2: a possible link between fatty acid excess and impaired glucose-induced insulin secretion? Diabetes 50:803–809
Echtay KS, Roussel D, St Pierre J, Jekabsons MB, Cadenas S, Stuart JA, Harper JA, Roebuck SJ, Morrison A, Pickering S, Clapham JC, Brand MD 2002 Superoxide activates mitochondrial uncoupling proteins. Nature 415:96–99
Koshkin V, Wang X, Scherer PE, Chan CB, Wheeler MB 2003 Mitochondrial functional state in clonal pancreatic ?-cells exposed to free fatty acids. J Biol Chem 278:19709–19715
Maedler K, Spinas GA, Dyntar D, Moritz W, Kaiser N, Donath MY 2001 Distinct effects of saturated and monounsaturated fatty acids on ?-cell turnover and function. Diabetes 50:69–76
Shimabukuro M, Wang MY, Zhou YT, Newgard CB, Unger RH 1998 Protection against lipoapoptosis of ? cells through leptin-dependent maintenance of Bcl-2 expression. Proc Natl Acad Sci USA 95:9558–9561
Chan CB, MacDonald PE, Saleh MC, Johns DC, Marban E, Wheeler MB 1999 Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes 48:1482–1486
Zhang CY, Baffy G, Perret P, Krauss S, Peroni O, Grujic D, Hagen T, Vidal-Puig AJ, Boss O, Kim YB, Zheng XX, Wheeler MB, Shulman GI, Chan CB, Lowell BB 2001 Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, ? cell dysfunction, and type 2 diabetes. Cell 105:745–755
Krauss S, Zhang CY, Scorrano L, Dalgaard LT, St Pierre J, Grey ST, Lowell BB 2003 Superoxide-mediated activation of uncoupling protein 2 causes pancreatic ? cell dysfunction. J Clin Invest 112:1831–1842
Hong Y, Fink BD, Dillon JS, Sivitz WI 2001 Effects of adenoviral overexpression of uncoupling protein-2 and -3 on mitochondrial respiration in insulinoma cells. Endocrinology 142:249–256
Wang MY, Shimabukuro M, Lee Y, Trinh KY, Chen JL, Newgard CB, Unger RH 1999 Adenovirus-mediated overexpression of uncoupling protein-2 in pancreatic islets of Zucker diabetic rats increases oxidative activity and improves ?-cell function. Diabetes 48:1020–1025
Jaburek M, Varecha M, Gimeno RE, Dembski M, Jezek P, Zhang M, Burn P, Tartaglia LA, Garlid KD 1999 Transport function and regulation of mitochondrial uncoupling proteins 2 and 3. J Biol Chem 274:26003–26007
Himms-Hagen J, Harper ME 2001 Physiological role of UCP3 may be export of fatty acids from mitochondria when fatty acid oxidation predominates: an hypothesis. Exp Biol Med 226:78–84
Li LX, Skorpen F, Egeberg K, Jorgensen IH, Grill V 2001 Uncoupling protein-2 participates in cellular defense against oxidative stress in clonal ?-cells. Biochem Biophys Res Commun 282:273–277
Armstrong MB, Towle HC 2001 Polyunsaturated fatty acids stimulate hepatic UCP-2 expression via a PPAR-mediated pathway. Am J Physiol 281:E1197–E1204
Kelly LJ, Vicario PP, Thompson GM, Candelore MR, Doebber TW, Ventre J, Wu MS, Meurer R, Forrest MJ, Conner MW, Cascieri MA, Moller DE 1998 Peroxisome proliferator-activated receptors and mediate in vivo regulation of uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression. Endocrinology 139:4920–4927
Patane G, Anello M, Piro S, Vigneri R, Purrello F, Rabuazzo AM 2002 Role of ATP production and uncoupling protein-2 in the insulin secretory defect induced by chronic exposure to high glucose or free fatty acids and effects of peroxisome proliferator-activated receptor- inhibition. Diabetes 51:2749–2756
Holness MJ, Smith ND, Greenwood GK, Sugden MC 2003 Acute (24 h) activation of peroxisome proliferator-activated receptor- (PPAR) reverses high-fat feeding-induced insulin hypersecretion in vivo and in perifused pancreatic islets. J Endocrinol 177:197–205
Koh EH, Kim MS, Park JY, Kim HS, Youn JY, Park HS, Youn JH, Lee KU 2003 Peroxisome proliferator-activated receptor (PPAR)- activation prevents diabetes in OLETF rats: comparison with PPAR- activation. Diabetes 52:2331–2337
Roduit R, Morin J, Masse F, Segall L, Roche E, Newgard CB, Assimacopoulos-Jeannet F, Prentki M 2000 Glucose down-regulates the expression of the peroxisome proliferator-activated receptor- gene in the pancreatic ?-cell. J Biol Chem 275:35799–35806
Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S, Weir GC 2002 Genetic regulation of metabolic pathways in ?-cells disrupted by hyperglycemia. J Biol Chem 277:10912–10921
Lupi R, Del Guerra S, Marselli L, Bugliani M, Boggi U, Mosca F, Marchetti P, Del Prato S 2004 Rosiglitazone prevents the impairment of human islet function induced by fatty acids: evidence for a role of PPAR2 in the modulation of insulin secretion. Am J Physiol 286:E560–E567
Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB, Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145:667–678
Berge K, Tronstad KJ, Bohov P, Madsen L, Berge RK 2003 Impact of mitochondrial ?-oxidation in fatty acid-mediated inhibition of glioma cell proliferation. J Lipid Res 44:118–127
Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159
Scatena R, Bottoni P, Martorana GE, Ferrari F, De Sole P, Rossi C, Giardina B 2004 Mitochondrial respiratory chain dysfunction, a non-receptor-mediated effect of synthetic PPAR-ligands: biochemical and pharmacological implications. Biochem Biophys Res Commun 319:967–973
Wang MY, Koyama K, Shimabukuro M, Mangelsdorf D, Newgard CB, Unger RH 1998 Overexpression of leptin receptors in pancreatic islets of Zucker diabetic fatty rats restores GLUT-2, glucokinase, and glucose-stimulated insulin secretion. Proc Natl Acad Sci USA 95:11921–11926
Lee Y, Yu X, Gonzales F, Mangelsdorf DJ, Wang MY, Richardson C, Witters LA, Unger RH 2002 PPAR is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissue. Proc Natl Acad Sci USA 99:11848–11853
Guerre-Millo M, Rouault C, Poulain P, Andre J, Poitout V, Peters JM, Gonzalez FJ, Fruchart JC, Reach G, Staels B 2001 PPAR--null mice are protected from high-fat diet-induced insulin resistance. Diabetes 50:2809–2814
Gremlich S, Nolan C, Roduit R, Burcelin R, Peyot ML, Delghingaro-Augusto V, Desvergne B, Michalik L, Prentki M, Wahli W 2005 Pancreatic islet adaptation to fasting is dependent on PPAR transcriptional up-regulation of fatty acid oxidation. Endocrinology 146:375–382
Feldhaus MJ, Weyrich AS, Zimmerman GA, McIntyre TM 2002 Ceramide generation in situ alters leukocyte cytoskeletal organization and ?2-integrin function and causes complete degranulation. J Biol Chem 277:4285–4293
Manna SK, Zhang HJ, Yan T, Oberley LW, Aggarwal BB 1998 Overexpression of manganese superoxide dismutase suppresses tumor necrosis factor-induced apoptosis and activation of nuclear transcription factor-B and activated protein-1. J Biol Chem 273:13245–13254
Suematsu N, Tsutsui H, Wen J, Kang D, Ikeuchi M, Ide T, Hayashidani S, Shiomi T, Kubota T, Hamasaki N, Takeshita A 2003 Oxidative stress mediates tumor necrosis factor--induced mitochondrial DNA damage and dysfunction in cardiac myocytes. Circulation 107:1418–1423
Lupi R, Dotta F, Marselli L, Del Guerra S, Masini M, Santangelo C, Patane G, Boggi U, Piro S, Anello M, Bergamini E, Mosca F, Di Mario U, Del Prato S, Marchetti P 2002 Prolonged exposure to free fatty acids has cytostatic and pro-apoptotic effects on human pancreatic islets: evidence that ?-cell death is caspase mediated, partially dependent on ceramide pathway, and Bcl-2 regulated. Diabetes 51:1437–1442
El Assaad W, Buteau J, Peyot ML, Nolan C, Roduit R, Hardy S, Joly E, Dbaibo G, Rosenberg L, Prentki M 2003 Saturated fatty acids synergize with elevated glucose to cause pancreatic ?-cell death. Endocrinology 144:4154–4163
Shimabukuro M, Zhou YT, Levi M, Unger RH 1998 Fatty acid-induced ? cell apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci USA 95:2498–2502
Corkey BE, Glennon MC, Chen KS, Deeney JT, Matschinsky FM, Prentki M 1989 A role for malonyl-CoA in glucose-stimulated insulin secretion from clonal pancreatic ?-cells. J Biol Chem 264:21608–21612
Prentki M, Vischer S, Glennon MC, Regazzi R, Deeney JT, Corkey BE 1992 Malonyl-CoA and long chain acyl-CoA esters as metabolic coupling factors in nutrient-induced insulin secretion. J Biol Chem 267:5802–5810
Liu YQ, Jetton TL, Leahy JL 2002 ?-Cell adaptation to insulin resistance. Increased pyruvate carboxylase and malate-pyruvate shuttle activity in islets of nondiabetic Zucker fatty rats. J Biol Chem 277:39163–39168
Sugden MC, Bulmer K, Augustine D, Holness MJ 2001 Selective modification of pyruvate dehydrogenase kinase isoform expression in rat pancreatic islets elicited by starvation and activation of peroxisome proliferator-activated receptor-: implications for glucose-stimulated insulin secretion. Diabetes 50:2729–2736
Farfari S, Schulz V, Corkey B, Prentki M 2000 Glucose-regulated anaplerosis and cataplerosis in pancreatic ?-cells: possible implication of a pyruvate/citrate shuttle in insulin secretion. Diabetes 49:718–726
Maechler P, Wollheim CB 1999 Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis. Nature 402:685–689
Sugden MC, Holness MJ 2004 Potential role of peroxisome proliferator-activated receptor- in the modulation of glucose-stimulated insulin secretion. Diabetes 53(Suppl 1):S71–S81
Rosen ED, Kulkarni RN, Sarraf P, Ozcan U, Okada T, Hsu CH, Eisenman D, Magnuson MA, Gonzalez FJ, Kahn CR, Spiegelman BM 2003 Targeted elimination of peroxisome proliferator-activated receptor in ? cells leads to abnormalities in islet mass without compromising glucose homeostasis. Mol Cell Biol 23:7222–7229
Department of Biochemistry and Molecular Biology, University of Southern Denmark (K.R., M.B., J.K.L., T.N., J.F., S.M.), 5230 Odense M, Denmark; and Department of Cell Physiology and Metabolism, University Medical Center (B.R., P.M.), CH-1211 Geneva 4, Switzerland
Address all correspondence and requests for reprints to: Dr. Susanne Mandrup, Department of Biochemistry and Molecular Biology University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark. E-mail: s.mandrup@bmb.sdu.dk.
Abstract
Fatty acids (FAs) are known to be important regulators of insulin secretion from pancreatic ?-cells. FA-coenzyme A esters have been shown to directly stimulate the secretion process, whereas long-term exposure of ?-cells to FAs compromises glucose-stimulated insulin secretion (GSIS) by mechanisms unknown to date. It has been speculated that some of these long-term effects are mediated by members of the peroxisome proliferator-activated receptor (PPAR) family via an induction of uncoupling protein-2 (UCP2). In this study we show that adenoviral coexpression of PPAR and retinoid X receptor (RXR) in INS-1E ?-cells synergistically and in a dose- and ligand-dependent manner increases the expression of known PPAR target genes and enhances FA uptake and ?-oxidation. In contrast, ectopic expression of PPAR/RXR increases FA uptake and deposition as triacylglycerides. Although the expression of PPAR/RXR leads to the induction of UCP2 mRNA and protein, this is not accompanied by reduced hyperpolarization of the mitochondrial membrane, indicating that under these conditions, increased UCP2 expression is insufficient for dissipation of the mitochondrial proton gradient. Importantly, whereas expression of PPAR/RXR attenuates GSIS, the expression of PPAR/RXR potentiates GSIS in rat islets and INS-1E cells without affecting the mitochondrial membrane potential. These results show a strong subtype specificity of the two PPAR subtypes and on lipid partitioning and insulin secretion when systematically compared in a ?-cell context.
Introduction
PEROXISOME PROLIFERATOR-ACTIVATED receptors (PPARs) are members of the nuclear receptor superfamily and are activated by fatty acids (FAs) and FA derivatives. These transcription factors are central regulators of lipid homeostasis, and are involved in regulating insulin sensitivity and cellular growth and differentiation (1). All members of the PPAR family (PPAR, -, and -) bind to PPAR-responsive elements as heterodimers with retinoid X receptor (RXR), another member of the nuclear receptor superfamily (2). The different PPAR subtypes show very limited subtype specificity in transient transfections and in the in vitro binding to PPAR-responsive elements, but it is evident from a number of in vivo and ex vivo studies that the different PPAR subtypes do have specialized functions when acting on endogenous genes. Thus, PPAR activates primarily genes encoding proteins involved in FA oxidation during fasting (3), whereas PPAR activates genes directly involved in lipogenic pathways and insulin signaling (4). The different biological actions of PPAR subtypes are undoubtedly due in part to the differential expression patterns of the PPAR subtypes; however, there are also indications that the PPARs are biochemically different and behave differently when ectopically expressed in the same cell (5).
All members of the PPAR family have been reported to be expressed in pancreatic ?-cells (6); however, several recent reports challenge the current dogma on the functions of the different subtypes. It was recently shown that PPAR ectopically expressed in INS-1 cells could induce lipid accumulation along with a modest increase in ?-oxidation (7). Likewise, others deduce that PPAR has lipooxidative potential promoting FA disposal in pancreatic ?-cells (8). This again disagrees with the conventional lipogenic role of PPAR, but is supported by reports indicating that PPAR ligands induce delipidation of pancreatic islets (9, 10). Thus, when related to findings in other tissues, the confusion about the direct function of PPAR subtypes in pancreatic ?-cell lipid partitioning is remarkable.
FAs are known to have profound effect on the ability of ?-cells to perform glucose-stimulated insulin secretion (GSIS) (1). It is well established that FAs acutely potentiate insulin secretion by glucose and other secretagogues in a manner dependent on both chain length and degree of saturation (11, 12). This effect is mediated by increased levels of intracellular long-chain FA-coenzyme A (FA-CoA) esters (13) as well as through direct activation of the G protein-coupled receptor 40 (14). Because FA oxidation decreases cytoplasmic levels of long-chain acyl-CoA esters, conditions that increase FA oxidation have been suggested to counteract the potentiating effect of FAs on insulin secretion (15).
In contrast to the acute effects of FAs on insulin secretion, exposure of ?-cells to high levels of FAs over a longer time (>24 h) leads to elevated basal insulin secretion and compromised GSIS, a phenomenon termed lipotoxicity. The molecular mechanisms underlying lipotoxicity are unclear, but they have been suggested to involve modulation of the glucose flux (16, 17), induction of uncoupling protein-2 (UCP2) (18, 19), activation of UCP2 by increased levels of reactive oxygen species (ROS) (20, 21), and facilitation of ceramide synthesis (22, 23).
Particular attention has recently been given to the role of UCP2 in modulating GSIS. It is well established that UCP2 activity in ?-cell mitochondria and GSIS capacity are negatively correlated in certain contexts (24, 25), and evidence was recently presented that this uncoupling activity is dependent on the generation of ROS (26). However, the physiological role of UCP2 in ?-cells explaining the evolutionary conservation remains less evident from these studies. Other reports indicate that UCP2 may facilitate FA oxidation. It was found that ectopic expression of UCP2 in either the INS-1 insulinoma cell line or Zucker diabetic fatty (ZDF) rat islets significantly accelerated FA oxidation (27, 28). This may be due to increased mitochondrial recycling of FAs (29, 30) or rapid neutralization of oxygen radicals (20, 31). Interestingly, both PPAR (7, 32) and PPAR (33, 34) have been reported to induce UCP2 expression in ?-cells and other cell types.
Hence, models positioning both PPAR and - as mediators of the adverse effects of FAs on ?-cell function have been suggested (7, 34). A significant reduction in GSIS by both ectopic PPAR expression and the PPAR agonist clofibrate led to the conclusion that PPAR activity could indeed cause ?-cell dysfunction, possibly through an induction of UCP2 (7). However, these results are at odds with the generally protective and restorative effects of PPAR activation in islets experiencing increased FA challenge (6, 35, 36). A net contribution of PPAR activation to ?-cell dysfunction also disagrees with the glucolipotoxicity hypothesis describing the additive toxic effect of elevated levels of FAs and glucose on ?-cell function as the ability of glucose to repress PPAR expression and, accordingly, FA oxidation (37, 38). Similarly, the finding that PPAR agonists counteract FA toxicity on pancreatic ?-cells (10, 36, 39) does not agree with PPAR being the mediator of FA induction of UCP2 and attenuation of GSIS (34)
The inconsistent observations on the effects of PPAR and PPAR on lipid partitioning and ?-cell function prompted us to reinvestigate and directly compare the roles of these PPAR subtypes in ?-cell function. In the present work we show that acute ectopic expression of PPAR and RXR synergistically and in a PPAR subtype-specific manner increases FA uptake and oxidation capacity and induces UCP2 expression in the INS-1E rat ?-cell line. Interestingly, despite this increase in FA oxidation and UCP2 expression, transduction with PPAR/RXR potentiates GSIS of both INS-1E cells and isolated rat islets. In contrast, acute ectopic expression of PPAR and RXR does not affect FA oxidation, but induces massive accumulation of triglycerides and impairs GSIS. These results confirm the roles of PPAR as a catabolic and PPAR as a lipogenic transcription factor also when ectopically expressed in pancreatic ?-cells. Importantly, our results show that acute activation of PPAR potentiates, whereas acute activation of PPAR compromises, GSIS.
Materials and Methods
Cell culture
The cell line INS-1E was cultured as previously described (40). The cells in use were all at passage numbers between 50 and 70 and were used for experiments at 70–80% confluence. All media and supplements were obtained from Invitrogen Life Technologies, Inc. (Carlsbad, CA), and serum was purchased from HyClone (Logan, UT). Rat islets were isolated using collagenase digestion and cultured 24 h before experiments in RPMI 1640 supplemented as described (40).
Adenovirus generation and transduction
Recombinant adenoviruses containing full-length mouse PPAR, PPAR2, and RXR were generated using the AdEasy cloning system from Stratagene (La Jolla, CA). The three genes were initially cloned into pShuttle-CMV using SalI and EcoRV restriction sites and were moved to AdEasy-1 by homologous recombination. The linearized plasmids were transfected into 293-HEK cells, and the virus was amplified and purified using CsCl gradients. Viruses were initially titrated, and titers were estimated by a plaque assay-based approach. Subsequently, relative titers of functional viruses were equalized based on quantification of the adenoviral transcript AdE4 by real-time PCR. Relative titers 1, 2, 5, and 25 correspond to 4, 8, 20, and 100 plaque-forming units/cell respectively.
After medium removal, cells were washed once in PBS and transduced for 90 min in RPMI 1640 supplemented as described above. Viruses were removed, and new medium containing specific agonists was added for an additional 24- or 48-h incubation. In all experiments, equal total amounts of AdVector were used as a control, and dimethylsulfoxide (DMSO) was added to the incubation medium. All experiments for RNA and protein extraction were performed in duplicate.
[1-14C]Oleate uptake
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were washed twice in Hanks’ buffered salt solution (HBSS) and incubated for 30 min in HBSS and 10 μM oleate (3 nCi/ml [1-14C]oleate; Pharmacia Biotech, Uppsala, Sweden). Oleate uptake was stopped by the addition of ice-cold stop solution (HBSS and 2% BSA), and cells were washed three times herein and once in ice-cold PBS. The 14C content was quantified and normalized to total DNA per well. Dishes without cells were treated in parallel, and values were used for background subtraction. Experiments were performed in triplicate.
[1-14C]Oleate oxidation
Oleate oxidation over 4 h of transduced INS-1E cells (relative titer, 1, 2, 5, and 25; 24-h incubation) was measured by quantification of collected 14CO2 essentially as described by Berge et al. (41). Data were normalized to total cellular protein. Dishes without cells were treated in parallel and used for background subtraction. Experiments were performed in triplicate.
[1-14C]Glucose oxidation
Glucose oxidation of transduced INS-1E cells (relative titer, 5) was measured by quantification of 14CO2 produced from oxidation of [1-14C]glucose. Cells were harvested in supplemented RPMI 1640 with 5 mM glucose and collected in sealed glass tubes. Glucose was raised to 16.7 mM (0.4 μCi [1-14C]glucose/tube), and cells were incubated for 30 min at 37 C. Collection, quantification, and normalization of 14CO2 were performed as described above (40). Experiments were performed in triplicate.
Lipid accumulation assay
INS-1E cells were seeded on Falcon chamber slides (BD Biosciences, Franklin Lakes, NJ), transduced with viruses (relative titer, 2), and incubated for 48 h with DMSO or specific agonists as described. Cells were fixed in ice-cold PBS/4% paraformaldehyde, washed in 70% ethanol, and stained with Nile Red (1 ng/μl; Sigma-Aldrich Corp., St. Louis, MO). Stained cells were washed three times in ice-cold 70% ethanol. Lipid accumulation was visualized by confocal laser scanning microscopy (excitation, 543 nm) using the LSM 510 Meta confocal microscope (Carl Zeiss, Inc., New York, NY).
Protein analysis by Western blotting and ECL detection
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were harvested in hypotonic lysis buffer containing sodium dodecyl sulfate and separated by SDS-PAGE. Proteins were blotted onto polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA) and probed with specific antibodies. All primary antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA): anti-PPAR (SC-7273), anti-RXR (SC-553), antitranscription factor-IIB (anti-TFIIB; SC-225), and anti-UCP2 (SC-20). Secondary horseradish peroxidase-coupled anti-Fc antibodies, antimouse (P0447) and antirabbit (P0399), were obtained from DakoCytomation (Carpinteria, CA).
RNA isolation and cDNA synthesis
Transduced INS-1E cells (relative titer, 1, 2, and 5; 24-h incubation) were harvested in guanidium thiocyanate, and RNA was isolated according to a modified Chomczynski-Sacchi protocol (42). cDNA was prepared after deoxyribonuclease I treatment (Invitrogen Life Technologies, Inc.) by RT (Invitrogen Life Technologies, Inc., First-Strand Kit) of the isolated RNA primed by random hexamers (dexoy-NTP6).
Real-time PCR
Quantitative three-step real-time PCR was performed on the ABI-7700 PRISM real-time PCR instrument (Applied Biosystems, Foster City, CA) using 2x SYBR Green Master Mix (Sigma-Aldrich Corp.) and Sigma passive reference according to instructions from the manufacturer. PCRs were performed in duplicate. Primers for real-time PCR were designed using Primer Express 2.0 (Applied Biosystems), and specificity and efficacy were validated before use. All quantifications were performed with TFIIB as the internal standard and are presented as the fold increase over the control value.
Primer sequences (forward and reverse, respectively) are as follows: RXR, CCTGCCGAGACAACAAGGA and ACCGGTTCCGCTGTCTCTT; PPAR, GTACCACTACGGAGTTCACGCAT and CGCCGAAAGAAGCCCTTAC; PPAR, CACAATGCCATCAGGTTTGG and CAGCTTCTCCTTCTCGGCCT; carnitine palmitoyl transferase-1a (CPT-1a), CTGGTGGGCCACAAATTACG and AGGTAGATATATTCTTCCCACCAGTCA; CPT-1b, TCCAAACATCACTGCCCAAG and GAATTGTGGCTGGCACACTG; UCP2, CCTACAGCGCCAGATGAGCT and GAGTCGTAGAGGCCAATGCG; medium-chain acyl-CoA dehydrogenase (MCAD), AGCTGCTAGTGGAGCACCAAG and TCGCCATTTCTGCGAGC; long-chain acyl-CoA dehydrogenase (LCAD), TCACCAATCGTGAAGCTCGA and CCAAAAAGAGGCTAATGCCATG; acyl-coenzyme A oxidase (ACO), CAGATAATTGGCACCTACGCC and AAGATGAGTTCCGTGGCCC; fatty acid transport protein-1 (FATP1), GTGTACCCCATCCGTCTGGT and CAGTGGCTCCATCGTGTCCT; FATP2, TGGACGCGATCATCTCTGG and TGTGGCGAAGGTTTCAAGGT; catalase, CGTGGGAAACAACACCCCTA and GGAAACAACATGGCATCCCT; perilipin, GGGACCTGTGAGTGCTTCCA and GTGGGCTTCTTTGGTGCTGT; pyruvate dehydrogenase kinase-4 (PDK4), CACGCTGGTCAAAGTTCGAA and GCCATCGTAGGGACCACATT; CD36, TTCTGCTGCACGAGGAGGA and AATGAGCCCACAGTTCCGAT; TFIIB, GTTCTGCTCCAACCTTTGCCT and TGTGTAGCTGCCATCTGCACTT; and AdE4, CTCCGGAACCACCACAGAAA and GCAGACATGTTTGAGAGAAAAATGG.
Mitochondrial membrane potential (m)
The m of transduced INS-1E cells (relative titer, 5; 24-h incubation) was measured using the fluorescent probe, rhodamine 123 (Molecular Probes, Eugene, OR) as described previously (40). Cells were maintained for 2 h in 2.5 mM glucose medium at 37 C before loading with 10 μg/ml rhodamine 123 for 20 min at 37 C in Krebs ringer bicarbonate HEPES. The m was monitored with excitation and emission filters set at 485 and 520 nm, respectively. Glucose (additions on top of basal, 2.5 mM), and then the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone was added to each well.
Insulin secretion
Insulin secretion from transduced INS-1E cells and rat islets (relative titer, 5; 24-h incubation) over a period of 30 min was measured by RIA using rat insulin as standard as previously described (40), and values were normalized to total insulin content.
Statistical analysis
Statistical evaluation of the data was performed using Student’s two-tailed t test on paired data. Data (fold increase over control value) are presented as the mean ± SD (n 3) or the mean ± range (n = 2).
Results
Synergy between adenovirally expressed PPAR and RXR in the INS-1E ?-cell line
It is well documented that both pancreatic islets from rodents and ?-cell-derived insulinoma cells express functional PPAR (6, 37). To investigate the acute effect of increased PPAR activity on target gene expression in pancreatic ?-cells, we transduced INS-1E cells with adenoviral vectors expressing PPAR. To investigate whether the endogenous level of RXR would become limiting for gene activation, we cotransduced with adenoviral vectors expressing RXR. INS-1E cells were transduced with the indicated viruses and cultured for 24 h with DMSO, the PPAR agonist WY14643, and/or the RXR agonist LG100268 as indicated. AdVector was used as a control. The viruses were all used with the relative titer 2 based on Ad4E expression (see Materials and Methods). Real-time PCR was used to quantify expression levels of the two classical PPAR target genes, CPT-1b and ACO (Fig. 1), which are rate-limiting for mitochondrial and peroxisomal FA oxidations, respectively. The expression of both genes was significantly induced by the specific agonists (P < 0.05–0.01) activating endogenous PPAR and RXR, and this induction was further potentiated by ectopic expression of the nuclear receptors. Interestingly, coexpression of AdPPAR and AdRXR synergistically increased the expression of the target genes in both the absence and the presence of exogenous ligands. Transactivation of the two target genes by PPAR/RXR in the absence of exogenous ligands indicates that either this transactivation is ligand independent, or significant levels of endogenous ligands are present in the INS-1E cells. However, the addition of receptor-specific, high affinity exogenous ligands potentiates the transaction of target genes by AdPPAR/AdRXR to levels 5- and 6-fold above basal levels (P < 0.002). The synergy between AdPPAR and AdRXR reveals that the endogenous level of RXR is not sufficient to fully support transcriptional activation by ectopically expressed PPAR, and that sequestration of RXR from other nuclear receptors could be an undesirable side effect of overexpressing PPAR alone. Thus, we chose to coexpress RXR with PPAR in subsequent experiments.
FIG. 1. PPAR and RXR synergistically activate the expression of target genes in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), RXR (R), or the empty adenoviral vector virus [AdVector (C)], as indicated at relative titer 2 (see Materials and Methods). Cells were subsequently cultured for 24 h with DMSO or the agonists WY14643 (30 μM) and LG100268 (200 nM) as indicated. The expression of CPT-1 and ACO was determined by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. Means not sharing the same superscript differ significantly (P < 0.05). The results presented are representative of at least three independent experiments.
Dose- and subtype-dependent effects of adenovirally expressed PPAR or PPAR together with RXR in INS-1E cells
To determine whether the effects on gene expression were specific for the PPAR subtype, we transduced INS-1E cells with increasing titers of adenoviruses expressing either PPAR or PPAR in combination with AdRXR. To ensure comparable virus titers, we performed both plaque assays and routinely monitored the expression of the adenoviral E4 transcript (AdE4). After transduction, INS-1E cells were cultured 24 h with DMSO or the specific agonist, WY14643 or BRL49653 together with LG100268. Quantitative real-time PCR was used to quantify the ectopic expression levels of the PPARs and RXR (Fig. 2A). Protein expression was determined by Western blotting (Fig. 2B). At the level of both mRNA and protein, ectopically expressed PPAR and PPAR were equally abundant. Also, RXR levels were comparable in the two sets of samples. Even very low doses of ectopically expressed PPAR or PPAR together with RXR produced a significant and highly subtype-specific response at the level of target gene expression. The expressions of ACO and perilipin were dose- and subtype-dependently increased by AdPPAR and AdPPAR transduction, respectively (P < 0.05–0.02; Fig. 2C). Only a modest effect of AdPPAR was seen on ACO expression levels, whereas AdPPAR had no effect on perilipin expression. Adenoviral expression of PPAR is, therefore, a valuable control for PPAR-specific effects in INS-1E cells and vice versa.
FIG. 2. Dose- and subtype-dependent effects of adenoviral expression of PPAR and - in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (or 25, protein only) and cultured 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). AdVector (C) was given, corresponding to a relative titer of 10 (or 50, protein). A and C, mRNA levels of AdPPAR, AdPPAR, and AdRXR as well as endogenous ACO and perilipin were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, Whole cell protein was extracted and separated by SDS-PAGE, and levels of AdPPAR, AdRXR, and TFIIB were determined by immunoblotting. *, P < 0.05; , P < 0.02 (significantly different from AdVector). All results presented are representative of at least three independent experiments.
FA uptake in INS-1E cells adenovirally transduced with PPAR or PPAR together with RXR
To study the metabolic effects of AdPPAR and - expression in ?-cells, INS-1E cells were transduced with the indicated viruses using relative titers 1, 2, and 5 and were subsequently cultured 24 h with DMSO or the specific agonist, WY14643 or BRL49653 together with LG100268. Total RNA was isolated, and expression levels of the FA transporters CD36, FATP1, and FATP2 were quantified by real-time PCR (Fig. 3A). Both AdPPAR and AdPPAR increased CD36 expression dramatically, whereas FATP1 expression was increased mainly by AdPPAR, and FATP2 was increased mainly by AdPPAR. FA uptake was measured by incubating the transduced cells with 14C-labeled oleate and subsequently quantifying the 14C content. In keeping with the increased expression of genes encoding FA transporters, both AdPPAR and AdPPAR increased FA uptake in the cells in a dose-dependent manner up to 2-fold (P < 0.05–0.001; Fig. 3B).
FIG. 3. Fatty acid transport is stimulated by adenoviral PPAR expression in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at the relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, mRNA levels of the FA transporters FATP1, FATP2, and CD36 were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, [1-14C]Oleate uptake over 30 min was measured in triplicate, normalized to total cellular DNA, and presented as the fold increase over the control (C) value. The SD is indicated. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02; , P < 0.01; #, P < 0.005; , P < 0.002; ||, P < 0.001). The results presented are representative for at least three independent experiments.
Subtype-specific effects of adenovirally expressed PPAR together with RXR on FA oxidation genes in INS-1E cells
To investigate the impact of PPAR on the metabolism of FAs taken up by the ?-cell, the expression levels of genes associated with FA oxidation was determined (Figs. 4 and 2C). All genes presented, PDK4, catalase, liver and muscle forms of CPT-1 (CPT-1a and -b), MCAD, LCAD, and ACO, were dose-dependently up-regulated by AdPPAR (P < 0.05–0.001), whereas AdPPAR only modestly affected expression levels. Thus, ectopic expression of PPAR/RXR in INS-1E cells induces genes involved in both mitochondrial and peroxisomal FA oxidation in a PPAR subtype-specific manner. Neither the expression of cytochrome c nor that of nuclear respiratory factor-1 was affected by AdPPAR (data not shown), indicating that mitochondrial biogenesis was not stimulated by PPAR in this system.
FIG. 4. FA oxidation genes are specifically induced by PPAR in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). The mRNA levels for genes involved in FA oxidation PDK4, catalase, CPT-1a, CPT-1b, MCAD, and LCAD were quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02; , P < 0.01; #, P < 0.005; ||, P < 0.001). The results presented are representative of at least three independent experiments.
FA and glucose oxidation in INS-1E cells adenovirally transduced with PPAR/RXR or PPAR/RXR
With increased FA uptake and induction of key factors in FA oxidation, PPAR would be expected to increase the FA oxidation capacity of the ?-cell. To address this, INS-1E cells were transduced with the indicated viruses and respective ligands. Mitochondrial ?-oxidation was determined in the presence or absence of etomoxir, an inhibitor of CPT-1 activity (Fig. 5A). AdPPAR/AdRXR dose-dependently increased oleate oxidation 4- to 12-fold (P < 0.05–0.02) in a manner completely blocked by etomoxir. In contrast, AdPPAR/AdRXR had no effect on ?-cell FA oxidation capacity, clearly demonstrating that increased ?-oxidation is a PPAR-specific effect. Oleate oxidation was also increased 2-fold (P < 0.05) by activation of endogenous PPAR with WY14643 (Fig. 5B) and was synergistically potentiated by concomitant RXR activation (5-fold; P < 0.005). By contrast, glucose oxidation was unaffected by ectopic expression of either PPAR subtype together with RXR (Fig. 5C).
FIG. 5. Oxidation of oleate, but not glucose, is stimulated by PPAR in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at relative titers of 1, 2, and 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, [1-14C]Oleate oxidation over 4 h was measured in triplicate, normalized to total cellular protein, and presented as the fold increase over the control (C) value (25E, 50 μM etomoxir added before ?-oxidation). B, [1-14C]Oleate oxidation over 4 h in nontransduced INS-1E cells treated 24 h with WY14643 and/or LG100268. C, [1-14C]Glucose oxidation over 30 min was measured in triplicate, normalized to total cellular protein, and presented as the fold increase over the control (C) value. The SD is indicated. Means significantly different from the control are indicated (*, P < 0.05; , P < 0.02; #, P < 0.005). The results presented are representative of at least three independent experiments.
Lipid accumulation in INS-1E cells adenovirally transduced with PPAR or PPAR alone or together with RXR
Because AdPPAR/AdRXR increased FA uptake, but not oxidation, an increased storage of FAs as triacylglycerides would be expected. To investigate this, INS-1E cells were fixed and stained with the lipophilic fluorescent dye, Nile Red, 48 h after transduction with the respective viruses (relative titer, 2; Fig. 6). No lipid accumulation was seen in the cells transduced with AdVector, AdPPAR, or AdPPAR/AdRXR. In contrast, comparable expression of AdPPAR facilitated massive accumulation of lipid droplets forming ring-like structures in the cytoplasm. This accumulation was potentiated by PPAR activation by the agonist BRL49653or by cotransduction with AdRXR. Neither of the ligands alone or in combination induced lipid accumulation (data not shown). Hence, ectopically expressed PPAR and PPAR subtypes specifically drive FAs taken up by the pancreatic ?-cell along two opposite pathways, leading to FA oxidation and accumulation as neutral lipids, respectively.
FIG. 6. PPAR facilitates lipid accumulation in INS-1E cells. INS-1E cells were transduced with adenovirus expressing PPAR, PPAR, RXR, or AdVector as indicated at a relative titer of 2. Cells were subsequently cultured for 48 h with DMSO or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). Nile Red staining and confocal fluorescence microscopy visualized triglyceride accumulation. The results presented are representative of at least three independent experiments.
UCP2 levels and m in INS-1E cells transduced with PPAR or PPAR together with RXRa
Previous studies have indicated a linkage between the UCP2 expression level and PPAR activity. We therefore investigated whether ectopic expression of PPAR/RXR would also increase UCP2 levels in this system. As shown in Fig. 7, A and B, AdPPAR/AdRXR markedly increased both the gene expression (P < 0.05–0.02) and the protein level of UCP2 in a receptor dose-dependent manner. Similar to other PPAR target genes (Fig. 1), UCP2 expression was significantly induced by exogenous ligands without ectopically expressed receptors and by coexpression of AdPPAR/AdRXR in the absence of exogenous ligands (data not shown). In contrast, transduction with AdPPAR/AdRXR resulted in a lower and dose-independent induction of UCP2 expression. The induction of UCP2 by PPAR was independent of FA oxidation, because etomoxir slightly potentiated, rather than blocked, the induction.
FIG. 7. PPAR increases UCP2 levels in INS-1E cells, but does not affect m. INS-1E cells were transduced with adenovirus expressing PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at the relative titers of 1, 2, and 5 (or 25, protein only). AdVector was given, corresponding to a relative titer of 10 (or 50, protein). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). A, UCP2 mRNA was quantified by real-time PCR, normalized to TFIIB expression, and presented as the fold increase over the control (C) value. RNA was harvested in duplicate, and the range is indicated. B, Whole cell protein was extracted and separated by SDS-PAGE, and levels of UCP2 and TFIIB were estimated by immunoblotting and determined by densiometric scanning. C, m was measured using rhodamine 123. Where indicated, glucose was increased to 15 mM. Means significantly different from AdVector are indicated (*, P < 0.05; , P < 0.02). All results presented are representative of at least three independent experiments.
To investigate whether the PPAR/RXR-induced increase in FA oxidation capacity and/or the increased UCP2 levels would affect the basal mitochondrial potential or the glucose-induced hyperpolarization of the mitochondrial membrane, the m was measured. INS-1E cells were transduced with AdPPAR/AdRXR or AdVector at a relative titer of 5 and were incubated 24 h with DMSO or the specific agonists. Cells were subsequently loaded with rhodamine-123 and incubated at low glucose (2.5 mM) before stimulation with 15 mM glucose as indicated (Fig. 7C). Despite increased UCP2 levels, AdPPAR/AdRXR affected neither basal m nor glucose-induced mitochondrial membrane hyperpolarization. In both the absence and the presence of ectopically expressed receptors, ligands slightly blunted the glucose-induced mitochondrial membrane hyperpolarization. This effect may be ascribed to a direct, PPAR-independent effect on the mitochondrial membrane during the 24-h incubation as reported by others (21, 43).
GSIS from INS-1E cells and rat islets adenovirally transduced with PPAR or PPAR together with RXR
The above results clearly demonstrate that ectopic AdPPAR/AdRXR expression increases FA uptake and oxidation and results in up-regulation of UCP2 expression without affecting m, whereas AdPPAR/AdRXR expression results in FA uptake and lipid accumulation. To investigate the overall effect on ?-cell GSIS, we transduced INS-1E cells with either AdPPAR/AdRXR or AdVector and cultured 24 h with DMSO (control) or the respective agonists. Insulin secretion was measured over a 30-min period of stimulation. AdPPAR/AdRXR significantly potentiated GSIS (+54%; P < 0.02), whereas basal insulin secretion was unaffected (Fig. 8A). In clear contrast, AdPPAR/AdRXR markedly impaired GSIS (–65%; P < 0.01) implicating subtype-specific effects of PPAR and PPAR on GSIS (Fig. 8B). Blocking FA oxidation with etomoxir did not compromise the potentiating effect of PPAR (Fig. 8C), suggesting that the potentiation of GSIS is caused by mechanisms other than increased ATP generation from FA oxidation. The cellular insulin content was not affected by the treatments (data not shown). In keeping with the effects of the ligands on m (Fig. 7B), the ligands caused a decrease in GSIS (data not shown), and ligands slightly decreased, rather than potentiated, the effect of PPAR/RXR on GSIS (Fig. 8A).
FIG. 8. PPAR potentiates GSIS in INS-1E cells and rat islets. INS-1E cells and rat islets were adenovirally transduced with PPAR (P), PPAR (P), RXR (R), or AdVector (C) as indicated at a relative titer of 5 (AdVector at a relative titer of 10). Cells were subsequently cultured for 24 h with DMSO (C) or the agonist WY14643 (30 μM) or BRL49653(1 μM) together with LG100268 (200 nM). Insulin secretion over 30 min in INS-1E cells (A–C) and rat islets (D) was quantified by RIA and normalized to total insulin content. C, GSIS was performed after 30-min preincubation in the presence of DMSO or 50 μM etomoxir (Etom). A–C: , 2.5 mM glucose; , 15 mM glucose. C: , 2.8 mM glucose; , 16.7 mM glucose. *, P < 0.02 vs. low glucose. The results presented are representative of at least two independent experiments.
Finally, we wanted to investigate whether AdPPAR/AdRXR would also potentiate GSIS in primary ?-cells. We therefore transduced isolated rat islets with AdPPAR/AdRXR or AdVector and cultured for 24 h. As shown in Fig. 8D, AdPPAR/ AdRXR specifically potentiated GSIS (+48%; P < 0.005) in primary rat ?-cells. In conclusion, ectopic expression of PPAR together with its heterodimerization partner, RXR, potentiated GSIS from both clonal INS-1E ?-cells and rat islets despite increased UCP2 levels and unaffected mitochondrial energy generation. In contrast, ectopic expression of PPAR and RXR significantly decreased GSIS.
Discussion
The role of PPARs in ?-cell physiology has been the focus of intense investigation. It is well known that all three PPAR subtypes are expressed in both islets and insulinoma cells, but their levels may vary considerably in response to other stimuli. A central role of PPAR in leptin signaling and functional restoration of islets from diabetic ZDF rats was pointed out by Unger’s group (6, 44) and later confirmed in a whole-body analysis comparing wild-type and PPAR-null animals (45). The abnormal FA metabolism and defects in insulin secretion of ZDF rat islets could partly be ascribed to subnormal levels of PPAR. This linkage between PPAR expression and normal ?-cell function was also supported by studies of islets exposed to hyperglycemic conditions (37, 38). In these studies it was shown that high glucose levels significantly repressed PPAR expression and FA oxidation, and it was suggested that this effect of glucose would be central to the concept of glucolipotoxicity.
Also administration of PPAR agonists has been reported to be beneficial for ?-cell function under conditions with lipid excess. Both in human and murine islets, thiazolidinedione compounds known as potent PPAR agonists have been shown to neutralize the adverse effects of FAs on ?-cell function (10, 36, 39). Whether these effect are mediated by PPAR dependent mechanisms is currently not known. However, in other studies ectopic expression of PPAR and acute administration of thiazolidinedione compounds to normal islets unexpectedly increased islet lipid oxidation and attenuated the GSIS (8). Moreover, counteracting PPAR function by chronic administration of a PPAR antagonist totally attenuates FA induction of UCP2 and restored GSIS (34), suggesting that PPAR mediates, rather than protects against, FA toxicity within the time frame of investigation.
Recently, the beneficial physiological effects of PPAR activity on islet cell function were questioned (7). Upon adenoviral transduction of INS-1 insulinoma cells with PPAR or treatment with high doses of the hypolipidemic drug clofibric acid, a suppression of basal and glucose-stimulated insulin secretion was seen. This impairment of ?-cell function was hypothesized to be caused by increased proton leakage from mitochondria due to elevated levels of UCP2, by depletion of cytosolic free FA pools due to increased FA oxidation, or by mitochondrial desensitization. Studies of islets isolated form PPAR knockout mice are ambiguous. Some investigators reported an unaltered glucose response in PPAR–/– islets (46), whereas others found that cultured islets from fasted PPAR–/– mice hypersecrete insulin over a broad range of glucose concentrations compared with islets from wild-type mice (47).
The conflicting reports on the roles of PPAR and - in ?-cells prompted us to reinvestigate the effects of these nuclear receptors on ?-cells by acutely and ectopically expressing either of the PPAR subtypes in balance with their common heterodimerization partner RXR in the highly differentiated rat ?-cell line INS-1E and in rat islets. In experiments using more long-term or chronic activation (or deactivation) of the PPARs, it is difficult to distinguish between primary and secondary effects of the PPAR subtypes. By contrast, the strategy employed in this study, i.e. acute ectopic expression of the PPARs by adenoviral vectors, allowed us to determine the direct effects of elevated PPAR or - activity in pancreatic ?-cells. In this first parallel analysis of the potencies of the PPAR and - subtypes, each subtype served as a valuable control for the specificity of the effects the other subtype. In addition, to determine whether endogenous PPARs play a role similar to that suggested by ectopic expression, we investigated the effects of acute treatment with PPAR ligands on ?-cell gene expression and function.
The synergy between PPAR and RXR revealed that the endogenous level of RXR is insufficient to fully support transcriptional activation by ectopically expressed PPAR. Sequestration of endogenous RXR from its other dimerization partners could therefore be an undesirable side effect of overexpressing the PPARs alone. Thus, RXR was coexpressed in subsequent experiments. We showed that coexpression of PPAR and RXR led to significant induction of target gene expression even in the absence of exogenous ligands. This finding indicates that either considerable amounts of endogenous ligands are present in INS-1E cells or these receptors are able to activate endogenous target genes in the absence of ligands.
We found that both PPAR and PPAR dose-dependently increased the FA uptake of INS-1E cells. However, the two PPARs directed the incoming FAs along different metabolic pathways. Whereas both activation of the endogenous PPAR and ectopically expressed PPAR induced ?-oxidation of the FAs, ectopic expression of PPAR facilitated lipid accumulation in the ?-cell. This subtype specificity in lipid partitioning was reflected in the strict subtype-specific induction of target genes, which is conserved even when the PPARs are ectopically expressed. This finding is important for the interpretation of our data, because it indicates that the specific effects elicited by the ectopically expressed PPARs to a very large extent reflect the potencies of endogenous PPARs. A change in the relative levels of the PPAR subtypes thus is acutely translated into different metabolic profiles of the ?-cell. Under normal physiological conditions, ?-cell expression of PPAR exceeds that of PPAR (6, 38). This is in line with our present findings that endogenous PPAR levels are sufficient to stimulate target gene expression and FA oxidation, whereas agonist activation of the endogenous PPAR affects neither target genes (results not shown) nor lipid accumulation (Fig. 6). It can be speculated that under hyperglycemic or hyperlipidemic conditions, the picture would change, mimicked by PPAR overexpression, and lipid accumulation would be facilitated.
In agreement with previous reports (7, 32), PPAR induced UCP2 expression. This increase was a direct effect of PPAR, rather than secondary to the increased FA oxidation, and was also reflected in increased UCP2 protein levels. Interestingly, neither basal m nor glucose-induced mitochondrial hyperpolarization was affected by increased PPAR activity and the resulting UCP2 induction. Thus, the moderate induction of UCP2 per se appeared not to uncouple the mitochondrial membrane. On the contrary, ligands of PPAR, PPAR, and RXR partially compromised the glucose-induced hyperpolarization of the mitochondrial membrane in a receptor-independent manner. This observation is probably due to the effects of these lipophilic compounds on mitochondrial respiratory chain function, as has been reported by others (21, 43).
Importantly, GSIS was significantly potentiated by PPAR/RXR expression in both INS-1E cells and rat islets despite the ability of PPAR/RXR to increase UCP2 levels. PPAR/RXR, in contrast, only increased UCP2 mRNA levels 1.5- to 2-fold, but severely reduced both basal insulin secretion and GSIS by approximately 55%. To understand the discrepancy between UCP2 induction and effects on insulin secretion, the activity of UCP2 should be considered. In recent reports, superoxide was pointed out as the endogenous activator of UCP2 uncoupling activity (21, 26) in a potentially protective feedback loop. It is also well known that ROS production is induced not only by mitochondrial oxidation processes through reduction of respiratory complex I (21), but also by complex lipids, such as ceramide, in various cell types (48, 49, 50). In ?-cells, ceramide generation is part of the lipotoxic/cytotoxic effect associated with exposure to saturated FAs and deposition of these rather than oxidation (22, 51, 52, 53). Thus, PPAR expression might increase ROS production through increased lipid uptake in cells not metabolically adjusted to handle this challenge. In contrast, PPAR turns on a complete program of lipid uptake, lipid oxidation, neutralization of ROS, and adaptation of the citric acid cycle. This potentially equilibrates the FA flux at a higher level without increasing ROS generation or compromising the discrete compliant pools of FAs in the cytoplasm predicted to contribute to the full insulin response (13, 54, 55).
Another important aspect in understanding the observed differences between the two PPAR subtypes on GSIS may be the PPAR-stimulated PDK4 expression and expected augmented anaplerotic flow into the citric acid cycle. Anaplerosis is critical to the insulin response, and inhibition of pyruvate dehydrogenase by PDK4 could sensitize the ?-cell to glucose (56, 57), potentially through increased formation of mitochondrial coupling factors (58, 59). Such a mechanism would be in agreement with the observed potentiation of GSIS in this study and our finding that elimination of the ATP contribution from FA oxidation during GSIS did not interfere with the positive effect of PPAR. In a recent review, Sugden and Holness (60) proposed a concept, for PPAR action on insulin secretion, also consistent with our present observations. Hence, increased PPAR activity could play a role in liporegulation through improved ?-cell function and compensatory insulin secretion in the hyperlipidemic state in vivo. The recent suggestion that PPAR activation by FAs is responsible for ?-cell adaptation to fasting conditions by reducing the pool of cytoplasmatic acyl-CoA esters critical for GSIS (47) is an interesting proposal and does not directly conflict with the present gain of function data. Our results show that acute activation of PPAR has a net potentiating effect on GSIS, but do not exclude that PPAR under some conditions could promote exhaustion of the cytoplasmic acyl-CoA pool and blunt GSIS. However, under our conditions this is either not rate limiting or is counteracted by other positive effects of PPAR.
The finding that acute ectopic expression of PPAR causes massive triglyceride accumulation in INS-1E cells is in keeping with the current view that PPAR is a lipogenic transcription factor. However, this observation is at odds with the findings of Parton et al. (8), who showed that ectopic expression of PPAR increases FA oxidation and decreases lipid accumulation in rat islets. It is possible that these discrepancies are due to differences in ectopic expression levels, the duration of the experiment (24 vs. 48 h), or the fact that Parton et al. (8) ectopically expressed PPAR1, whereas we expressed PPAR2. However, to date, significant functional differences between PPAR isoforms 1 and 2 have not been described. In our system, glucose oxidation was not significantly affected, and it appears more likely that the PPAR-induced attenuation of GSIS is due to the massive lipid accumulation and increased ceramide synthesis reported to result from such accumulation. However, in the chronic hyperlipidemic state, PPAR could be important for compensatory ?-cell hyperplasia, as suggested by islet studies of ?-cell-specific PPAR knockout mice (61).
In conclusion, a significant subtype specificity is observed when comparing PPAR and PPAR in pancreatic ?-cells. Acute ectopic expression of PPAR/RXR increases the FA oxidation capacity in INS-1E cells and results in a net potentiation of GSIS in both INS-1E cells and primary rat islets. The increased expression of UCP2 protein does not per se ablate glucose-stimulated hyperpolarization of the mitochondrial membrane, an observation in agreement with the idea that uncoupling by UCP2 requires activation by reactive oxygen species. The exact molecular mechanisms underlying the potentiation of GSIS by PPAR are unclear at this point, but may involve enhanced anaplerotic feeding of the citric acid cycle and generation of mitochondrial coupling factors. This would be in keeping with the activation of PDK4 expression by PPAR and the observation that the potentiation of GSIS is not dependent on ongoing FA oxidation or accompanied by an increase in m. In contrast, acute ectopic expression of PPAR/RXR increases triglyceride accumulation and leads to attenuation of GSIS. Of note, agonist activation of endogenous PPAR, but not PPAR, affects gene expression and lipid metabolism similarly to ectopic expression of the nuclear receptor. Hence, under the present normoglycemic and normolipidemic conditions, PPAR appears to be the functionally more important subtype.
Acknowledgments
We are grateful to Claes Wollheim for supplying the INS-1E cell line.
References
Ferre P 2004 The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 53(Suppl 1):S43–S50
Gearing KL, Gottlicher M, Teboul M, Widmark E, Gustafsson JA 1993 Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci USA 90:1440–1444
Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W 1999 Peroxisome proliferator-activated receptor mediates the adaptive response to fasting. J Clin Invest 103:1489–1498
Mueller E, Drori S, Aiyer A, Yie J, Sarraf P, Chen H, Hauser S, Rosen ED, Ge K, Roeder RG, Spiegelman BM 2002 Genetic analysis of adipogenesis through peroxisome proliferator-activated receptor isoforms. J Biol Chem 277:41925–41930
Brun RP, Tontonoz P, Forman BM, Ellis R, Chen J, Evans RM, Spiegelman BM 1996 Differential activation of adipogenesis by multiple PPAR isoforms. Genes Dev 10:974–984
Zhou YT, Shimabukuro M, Wang MY, Lee Y, Higa M, Milburn JL, Newgard CB, Unger RH 1998 Role of peroxisome proliferator-activated receptor in disease of pancreatic ? cells. Proc Natl Acad Sci USA 95:8898–8903
Tordjman K, Standley KN, Bernal-Mizrachi C, Leone TC, Coleman T, Kelly DP, Semenkovich CF 2002 PPAR suppresses insulin secretion and induces UCP2 in insulinoma cells. J Lipid Res 43:936–943
Parton LE, Diraison F, Neill SE, Ghosh SK, Rubino MA, Bisi JE, Briscoe CP, Rutter GA 2004 Impact of PPAR overexpression and activation on pancreatic islet gene expression profile analyzed with oligonucleotide microarrays. Am J Physiol 287:E390–E404
Higa M, Zhou YT, Ravazzola M, Baetens D, Orci L, Unger RH 1999 Troglitazone prevents mitochondrial alterations, ? cell destruction, and diabetes in obese prediabetic rats. Proc Natl Acad Sci USA 96:11513–11518
Shimabukuro M, Zhou YT, Lee Y, Unger RH 1998 Troglitazone lowers islet fat and restores ? cell function of Zucker diabetic fatty rats. J Biol Chem 273:3547–3550
Dobbins RL, Chester MW, Stevenson BE, Daniels MB, Stein DT, McGarry JD 1998 A fatty acid-dependent step is critically important for both glucose- and non-glucose-stimulated insulin secretion. J Clin Invest 101:2370–2376
Stein DT, Stevenson BE, Chester MW, Basit M, Daniels MB, Turley SD, McGarry JD 1997 The insulinotropic potency of fatty acids is influenced profoundly by their chain length and degree of saturation. J Clin Invest 100:398–403
Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V, Przybykowski E, Morin J, Masse F, Massie B, Ruderman N, Rhodes C, Poitout V, Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli. Diabetes 53:1007–1019
Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S, Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S, Fujisawa Y, Fujino M 2003 Free fatty acids regulate insulin secretion from pancreatic ? cells through GPR40. Nature 422:173–176
Rubi B, Antinozzi PA, Herrero L, Ishihara H, Asins G, Serra D, Wollheim CB, Maechler P, Hegardt FG 2002 Adenovirus-mediated overexpression of liver carnitine palmitoyltransferase I in INS1E cells: effects on cell metabolism and insulin secretion. Biochem J 364:219–226
Hosokawa H, Corkey BE, Leahy JL 1997 ?-Cell hypersensitivity to glucose following 24-h exposure of rat islets to fatty acids. Diabetologia 40:392–397
Yoshikawa H, Tajiri Y, Sako Y, Hashimoto T, Umeda F, Nawata H 2001 Effects of free fatty acids on ?-cell functions: a possible involvement of peroxisome proliferator-activated receptors or pancreatic/duodenal homeobox. Metabolism 50:613–618
Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272
Lameloise N, Muzzin P, Prentki M, Assimacopoulos-Jeannet F 2001 Uncoupling protein 2: a possible link between fatty acid excess and impaired glucose-induced insulin secretion? Diabetes 50:803–809
Echtay KS, Roussel D, St Pierre J, Jekabsons MB, Cadenas S, Stuart JA, Harper JA, Roebuck SJ, Morrison A, Pickering S, Clapham JC, Brand MD 2002 Superoxide activates mitochondrial uncoupling proteins. Nature 415:96–99
Koshkin V, Wang X, Scherer PE, Chan CB, Wheeler MB 2003 Mitochondrial functional state in clonal pancreatic ?-cells exposed to free fatty acids. J Biol Chem 278:19709–19715
Maedler K, Spinas GA, Dyntar D, Moritz W, Kaiser N, Donath MY 2001 Distinct effects of saturated and monounsaturated fatty acids on ?-cell turnover and function. Diabetes 50:69–76
Shimabukuro M, Wang MY, Zhou YT, Newgard CB, Unger RH 1998 Protection against lipoapoptosis of ? cells through leptin-dependent maintenance of Bcl-2 expression. Proc Natl Acad Sci USA 95:9558–9561
Chan CB, MacDonald PE, Saleh MC, Johns DC, Marban E, Wheeler MB 1999 Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes 48:1482–1486
Zhang CY, Baffy G, Perret P, Krauss S, Peroni O, Grujic D, Hagen T, Vidal-Puig AJ, Boss O, Kim YB, Zheng XX, Wheeler MB, Shulman GI, Chan CB, Lowell BB 2001 Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, ? cell dysfunction, and type 2 diabetes. Cell 105:745–755
Krauss S, Zhang CY, Scorrano L, Dalgaard LT, St Pierre J, Grey ST, Lowell BB 2003 Superoxide-mediated activation of uncoupling protein 2 causes pancreatic ? cell dysfunction. J Clin Invest 112:1831–1842
Hong Y, Fink BD, Dillon JS, Sivitz WI 2001 Effects of adenoviral overexpression of uncoupling protein-2 and -3 on mitochondrial respiration in insulinoma cells. Endocrinology 142:249–256
Wang MY, Shimabukuro M, Lee Y, Trinh KY, Chen JL, Newgard CB, Unger RH 1999 Adenovirus-mediated overexpression of uncoupling protein-2 in pancreatic islets of Zucker diabetic rats increases oxidative activity and improves ?-cell function. Diabetes 48:1020–1025
Jaburek M, Varecha M, Gimeno RE, Dembski M, Jezek P, Zhang M, Burn P, Tartaglia LA, Garlid KD 1999 Transport function and regulation of mitochondrial uncoupling proteins 2 and 3. J Biol Chem 274:26003–26007
Himms-Hagen J, Harper ME 2001 Physiological role of UCP3 may be export of fatty acids from mitochondria when fatty acid oxidation predominates: an hypothesis. Exp Biol Med 226:78–84
Li LX, Skorpen F, Egeberg K, Jorgensen IH, Grill V 2001 Uncoupling protein-2 participates in cellular defense against oxidative stress in clonal ?-cells. Biochem Biophys Res Commun 282:273–277
Armstrong MB, Towle HC 2001 Polyunsaturated fatty acids stimulate hepatic UCP-2 expression via a PPAR-mediated pathway. Am J Physiol 281:E1197–E1204
Kelly LJ, Vicario PP, Thompson GM, Candelore MR, Doebber TW, Ventre J, Wu MS, Meurer R, Forrest MJ, Conner MW, Cascieri MA, Moller DE 1998 Peroxisome proliferator-activated receptors and mediate in vivo regulation of uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression. Endocrinology 139:4920–4927
Patane G, Anello M, Piro S, Vigneri R, Purrello F, Rabuazzo AM 2002 Role of ATP production and uncoupling protein-2 in the insulin secretory defect induced by chronic exposure to high glucose or free fatty acids and effects of peroxisome proliferator-activated receptor- inhibition. Diabetes 51:2749–2756
Holness MJ, Smith ND, Greenwood GK, Sugden MC 2003 Acute (24 h) activation of peroxisome proliferator-activated receptor- (PPAR) reverses high-fat feeding-induced insulin hypersecretion in vivo and in perifused pancreatic islets. J Endocrinol 177:197–205
Koh EH, Kim MS, Park JY, Kim HS, Youn JY, Park HS, Youn JH, Lee KU 2003 Peroxisome proliferator-activated receptor (PPAR)- activation prevents diabetes in OLETF rats: comparison with PPAR- activation. Diabetes 52:2331–2337
Roduit R, Morin J, Masse F, Segall L, Roche E, Newgard CB, Assimacopoulos-Jeannet F, Prentki M 2000 Glucose down-regulates the expression of the peroxisome proliferator-activated receptor- gene in the pancreatic ?-cell. J Biol Chem 275:35799–35806
Laybutt DR, Sharma A, Sgroi DC, Gaudet J, Bonner-Weir S, Weir GC 2002 Genetic regulation of metabolic pathways in ?-cells disrupted by hyperglycemia. J Biol Chem 277:10912–10921
Lupi R, Del Guerra S, Marselli L, Bugliani M, Boggi U, Mosca F, Marchetti P, Del Prato S 2004 Rosiglitazone prevents the impairment of human islet function induced by fatty acids: evidence for a role of PPAR2 in the modulation of insulin secretion. Am J Physiol 286:E560–E567
Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB, Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145:667–678
Berge K, Tronstad KJ, Bohov P, Madsen L, Berge RK 2003 Impact of mitochondrial ?-oxidation in fatty acid-mediated inhibition of glioma cell proliferation. J Lipid Res 44:118–127
Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159
Scatena R, Bottoni P, Martorana GE, Ferrari F, De Sole P, Rossi C, Giardina B 2004 Mitochondrial respiratory chain dysfunction, a non-receptor-mediated effect of synthetic PPAR-ligands: biochemical and pharmacological implications. Biochem Biophys Res Commun 319:967–973
Wang MY, Koyama K, Shimabukuro M, Mangelsdorf D, Newgard CB, Unger RH 1998 Overexpression of leptin receptors in pancreatic islets of Zucker diabetic fatty rats restores GLUT-2, glucokinase, and glucose-stimulated insulin secretion. Proc Natl Acad Sci USA 95:11921–11926
Lee Y, Yu X, Gonzales F, Mangelsdorf DJ, Wang MY, Richardson C, Witters LA, Unger RH 2002 PPAR is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissue. Proc Natl Acad Sci USA 99:11848–11853
Guerre-Millo M, Rouault C, Poulain P, Andre J, Poitout V, Peters JM, Gonzalez FJ, Fruchart JC, Reach G, Staels B 2001 PPAR--null mice are protected from high-fat diet-induced insulin resistance. Diabetes 50:2809–2814
Gremlich S, Nolan C, Roduit R, Burcelin R, Peyot ML, Delghingaro-Augusto V, Desvergne B, Michalik L, Prentki M, Wahli W 2005 Pancreatic islet adaptation to fasting is dependent on PPAR transcriptional up-regulation of fatty acid oxidation. Endocrinology 146:375–382
Feldhaus MJ, Weyrich AS, Zimmerman GA, McIntyre TM 2002 Ceramide generation in situ alters leukocyte cytoskeletal organization and ?2-integrin function and causes complete degranulation. J Biol Chem 277:4285–4293
Manna SK, Zhang HJ, Yan T, Oberley LW, Aggarwal BB 1998 Overexpression of manganese superoxide dismutase suppresses tumor necrosis factor-induced apoptosis and activation of nuclear transcription factor-B and activated protein-1. J Biol Chem 273:13245–13254
Suematsu N, Tsutsui H, Wen J, Kang D, Ikeuchi M, Ide T, Hayashidani S, Shiomi T, Kubota T, Hamasaki N, Takeshita A 2003 Oxidative stress mediates tumor necrosis factor--induced mitochondrial DNA damage and dysfunction in cardiac myocytes. Circulation 107:1418–1423
Lupi R, Dotta F, Marselli L, Del Guerra S, Masini M, Santangelo C, Patane G, Boggi U, Piro S, Anello M, Bergamini E, Mosca F, Di Mario U, Del Prato S, Marchetti P 2002 Prolonged exposure to free fatty acids has cytostatic and pro-apoptotic effects on human pancreatic islets: evidence that ?-cell death is caspase mediated, partially dependent on ceramide pathway, and Bcl-2 regulated. Diabetes 51:1437–1442
El Assaad W, Buteau J, Peyot ML, Nolan C, Roduit R, Hardy S, Joly E, Dbaibo G, Rosenberg L, Prentki M 2003 Saturated fatty acids synergize with elevated glucose to cause pancreatic ?-cell death. Endocrinology 144:4154–4163
Shimabukuro M, Zhou YT, Levi M, Unger RH 1998 Fatty acid-induced ? cell apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci USA 95:2498–2502
Corkey BE, Glennon MC, Chen KS, Deeney JT, Matschinsky FM, Prentki M 1989 A role for malonyl-CoA in glucose-stimulated insulin secretion from clonal pancreatic ?-cells. J Biol Chem 264:21608–21612
Prentki M, Vischer S, Glennon MC, Regazzi R, Deeney JT, Corkey BE 1992 Malonyl-CoA and long chain acyl-CoA esters as metabolic coupling factors in nutrient-induced insulin secretion. J Biol Chem 267:5802–5810
Liu YQ, Jetton TL, Leahy JL 2002 ?-Cell adaptation to insulin resistance. Increased pyruvate carboxylase and malate-pyruvate shuttle activity in islets of nondiabetic Zucker fatty rats. J Biol Chem 277:39163–39168
Sugden MC, Bulmer K, Augustine D, Holness MJ 2001 Selective modification of pyruvate dehydrogenase kinase isoform expression in rat pancreatic islets elicited by starvation and activation of peroxisome proliferator-activated receptor-: implications for glucose-stimulated insulin secretion. Diabetes 50:2729–2736
Farfari S, Schulz V, Corkey B, Prentki M 2000 Glucose-regulated anaplerosis and cataplerosis in pancreatic ?-cells: possible implication of a pyruvate/citrate shuttle in insulin secretion. Diabetes 49:718–726
Maechler P, Wollheim CB 1999 Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis. Nature 402:685–689
Sugden MC, Holness MJ 2004 Potential role of peroxisome proliferator-activated receptor- in the modulation of glucose-stimulated insulin secretion. Diabetes 53(Suppl 1):S71–S81
Rosen ED, Kulkarni RN, Sarraf P, Ozcan U, Okada T, Hsu CH, Eisenman D, Magnuson MA, Gonzalez FJ, Kahn CR, Spiegelman BM 2003 Targeted elimination of peroxisome proliferator-activated receptor in ? cells leads to abnormalities in islet mass without compromising glucose homeostasis. Mol Cell Biol 23:7222–7229