Identification of TRAIL as an Interferon Regulator
http://www.100md.com
病菌学杂志 2005年第14期
Department of Pathology, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, Massachusetts 02115
ABSTRACT
Interferon production and apoptosis in virus-infected cells are necessary to prevent progeny virus production and to eliminate infected cells. Paramyxovirus infection induces apoptosis through interferon regulatory factor 3 (IRF-3), but the exact mechanism of how IRF-3 functions is unknown. We show that IRF-3 is involved in the transcriptional induction of TRAIL, a key player in the apoptosis pathway. IRF-3 upregulates TRAIL transcription following viral infection and binds an interferon-stimulated response element in the TRAIL promoter. The mRNA for TRAIL and its receptor, DR5, are induced following viral infection. These studies identify TRAIL as a novel IRF-3 transcriptional target.
TEXT
Viral infection results in a swift innate cellular response against potential lytic infection, transformation and/or apoptosis, which is characterized by the production of alpha interferon (IFN-) and IFN-?. This signaling results in activation of IFN-stimulated genes (ISGs) that mediate the effects of IFN. IFN regulatory factors (IRFs) are a family of nine cellular factors that bind to consensus IFN-stimulated response elements (ISREs) and induce other ISGs (15, 24).
IRF-3 is unique among IRFs because it is constitutively expressed and is posttranslationally activated immediately following infection by several classes of viruses (11, 27). Upon viral infection, Tank binding kinase 1 and I kinase 1 (8, 22) phosphorylate the C-terminal residues required for activation of cytoplasmic IRF-3 (14, 21). IRF-3 then translocates to the nucleus, where it potentiates a transcription complex composed of CREB binding protein or p300, ATF/c-jun, and NFB, activating the transcription of IFN-? (10, 14, 27).
Infection by many viruses leads to apoptosis by two major pathways that initiate downstream of a death signal; however, the mechanism that triggers programmed cell death is not completely understood. Type I IFNs have been implicated as essential mediators of apoptosis (23); however, cell death after viral infection can also be initiated independently of IFN (28). Overexpression of a constitutively active IRF-3 mutant leads to apoptosis in Jurkat and 293 cells, and expression of wild-type IRF-3 can augment virus-induced apoptosis (10). Interestingly, the role of IRF-3 in virus-induced apoptosis was found to be both IFN and p53 independent (28). In this study, we explored the mechanism by which IRF-3 might mediate the apoptotic response to Sendai virus (SeV) infection.
SeV infection leads to transcriptional upregulation of TRAIL. Heylbroeck et al. (10) and Weaver et al. (28) have implicated caspase 8 as a downstream effector in SeV-induced apoptosis. To identify the SeV-induced apoptotic signals upstream of caspase 8, we infected both primary (human foreskin keratinocytes [HFK]) and tumor (human colonic adenocarcinoma cells [HT-29]) cell lines with SeV and analyzed mRNA expression profiles by RNase protection using probe sets for mRNAs in the tumor necrosis factor (TNF) family. Total cell mRNA was isolated at various times from control or SeV-infected cells, and the RNase protection products were resolved by polyacrylamide gel electrophoresis. Figure 1A and B show results from HFK cells. The induction of IFN-? mRNA served as a positive control (24, 25), with a strong upregulation observed at 4 h postinfection (Fig. 1B). Interestingly, for the hApo3d probe set, only the TRAIL (TNF-related apoptosis-inducing ligand) mRNA was strongly up-regulated post SeV infection at 4 h, similar to IFN-? mRNA (Fig. 1A). In addition, we noted the expression of its signaling receptor, DR5, prior to viral infection at 0 h, and that was further upregulated, albeit not to the high levels seen for TRAIL mRNA (Fig. 1A).
The cell type specificity of TRAIL mRNA upregulation was investigated by using the human colon adenocarcinoma cell line, HT-29, previously used to examine the human TRAIL promoter (9, 26). We confirmed that both TRAIL and DR5 mRNAs were upregulated at 3 h after infection (Fig. 1C). The mRNAs for the nonsignaling TRAIL receptors DcR1 and DcR2 were not upregulated in either cell type. The induction of TRAIL mRNA in both transformed and primary cell lines thus implicated TRAIL as a potential mediator of virus-induced apoptosis.
To determine whether IRF-3 might play a role in SeV-induced TRAIL expression, we performed RNase protection analysis using IRF-3-transfected cells. Previous experiments that demonstrated a role for IRF-3 in SeV-induced apoptosis had also been performed with IRF-3-transfected cells (10, 28). To avoid possible secondary effects arising from IFN signaling, HEC-1B cells (which lack the IFN receptor) (28) were transfected with either the vector control or an IRF-3 expression plasmid 24 h prior to infection with SeV. As shown in Fig. 1D, TRAIL mRNA was strongly induced in the IRF-3-transfected cells and not in the vector-transfected cells, indicating that IRF-3 contributes to SeV activation of TRAIL transcription.
IRF-3 transactivates the TRAIL promoter following SeV infection. A TRAIL luciferase reporter construct was cotransfected with plasmids expressing members of the IRF family of transcription factors into HEC-1B cells 18 h prior to SeV infection. The functionality of all expression constructs was verified using an IFN-? luciferase reporter (data not shown). In addition, two IRF-3 mutants (IRF-3 5D and IRF-3N60) were tested for the ability to transactivate the TRAIL promoter. Constitutively active IRF-3 5D contains phosphomimetic substitutions of aspartic acid in the carboxy-terminal cluster of serines and threonines (14). IRF-3 N60 lacks 60 amino acids of the DNA binding domain (IRF-3 N60) and functions in a dominant negative fashion (28). Luciferase levels were measured 16 h after SeV infection (Fig. 2). IRF-3 activated the TRAIL promoter about sevenfold after infection compared to the uninfected IRF-3-expressing cells. Neither IRF-1, IRF-2, nor IRF-7 activated the TRAIL promoter reporter (5). As anticipated, IRF-3 5D activated the TRAIL promoter whereas IRF-3 N60 inhibited transactivation of the TRAIL promoter. These data demonstrated that IRF-3 was the only IRF family member tested that could activate the –1371 TRAIL promoter.
To determine whether the TRAIL promoter contained an IRF-3 response element, we used the TRANSFAC (http://www.gene-regulation.com) internet-based transcription factor binding site program. Examination of the 1.5-kb TRAIL promoter revealed several potential consensus response elements for NFB, AP-1, NFAT, Sp1, Oct-1, and IRFs (9, 26). The locations of these elements in the TRAIL promoter are shown in Fig. 3.
In addition, previous analysis of the TRAIL promoter performed with Jurkat cells and human colon cancer cells had revealed two IFN-responsive regions that contribute to promoter activity (9, 26). Furthermore, the putative ISRE close to the start site of the TRAIL gene (from –121 to –140) is similar in sequence to the ISRE of the RANTES promoter, to which IRF-3 has been previously been shown to bind (13).
IRF-3 binds the TRAIL promoter following SeV infection in HT-29 cells. To determine whether IRF-3 binds to the upstream TRAIL ISRE identified by TRANSFAC analysis, we performed no-shift (Novagen) analysis. No-shift assays are similar to electrophoretic mobility shift assays but use an enzyme-linked immunosorbent assay-based format. We prepared nuclear extracts from HT-29 cells that were either untreated or SeV infected. Extracts were incubated with a TRAIL ISRE (5' GCTTCTTTCAGTTTCCCTCCTTTCCAACGA) or ISG15 ISRE (5' ATGCCTCGGGAAAGGGAAACCGAAACTGAAGCCA) double-stranded biotinylated oligonucleotide and transferred to a streptavidin-coated plate. Bound transcription factors were detected using IRF-3-, IRF-7-, and ISGF3-specific antibodies (Santa Cruz), followed by a secondary antibody conjugated to horseradish peroxidase. The complexes were detected by a chromogenic reaction with a tetramethylbenzidine substrate. Figure 4A and B demonstrate that IRF-3 bound both the TRAIL and ISG15 ISREs threefold and sixfold, respectively, above the background following SeV infection. No significant binding of IRF-7 or ISGF3 was observed with either oligonucleotide. An unrelated TNF--specific antibody showed no increase in signal intensity with either oligonucleotide using extract from SeV-infected cells (data not shown).
To confirm the interaction of IRF-3 with the TRAIL ISRE, we mutated nucleotides corresponding to those important for IRF-3 binding in the RANTES ISRE (13). These mutant biotinylated oligonucleotides (Mut 1, 5' TTATTTCAATTTCCCTC; Mut 2, 5' TTCTTTCAGAAACCCTCCTTT [mutated bases are underlined]) were incubated with extracts as described above. The amount of IRF-3 bound was detected with the IRF-3 monoclonal SL-12 antibody (18). Figure 4C shows an increase in signal intensity with wild-type TRAIL ISRE but not with the two mutant TRAIL ISREs.
To determine the responsiveness of IRF-3 to ISRE mutations, we constructed mutant versions of the full-length TRAIL promoter containing mutants 1 and 2. These reporters were transfected with an IRF-3 expression plasmid into HEC-1B cells, and luciferase assays were performed following SeV infection. Interestingly, the ISRE mutations significantly impaired both the basal and SeV-activated levels of the TRAIL reporters (data not shown). Thus, the mutations introduced into the TRAIL promoter ISRE may affect the interaction of cellular transcription factors involved in basal, as well as IRF-3-induced, transcription.
In this study, we have discovered that cells upregulate TRAIL in response to SeV infection and that IRF-3 regulates TRAIL at the transcriptional level, thus defining a novel transcriptional target for IRF-3. TRAIL has been shown to be part of the cellular response to infection by several viruses (for a review, see reference 4). Work by Clarke et al. (7) implicated TRAIL as a mediator of reovirus-induced apoptosis, and both TRAIL mRNA and TRAIL DR5 mRNAs are upregulated following infection by reovirus, as well as by cytomegalovirus (7, 20).
As many signaling pathways, including NFB and ATF/c-jun, are also activated following SeV infection, it is likely that TRAIL induction, like IFN-?, may result from the activation of several signaling pathways, not only IRF-3. Indeed, several potential response elements have been described within the TRAIL promoter, including those for CEBP, AP-1, GATA, NFAT, NFB, and SP-1 (9, 26) in addition to the ISREs (this study and reference 3).
TRAIL transcriptional regulation has been largely studied in cells of hematopoietic origin. The IRF family member ISGF3 is critical for the regulation of murine TRAIL in natural killer cells (19). In Jurkat T cells, NFB is a crucial regulator of TRAIL expression (3). In many other cell lines, TRAIL can be regulated by IFN-/? and IFN- and by IRF-1 (6, 12, 17). It is therefore possible that different IRFs may be able to bind to ISRE upstream elements in the TRAIL promoter, depending on the cell type.
Interestingly, TRAIL has two decoy receptors (DcR1, DcR2) preferentially expressed on normal cells and two death receptors (DR4, DR5) preferentially expressed on tumor cells (1, 2, 16). We have shown that DR5 mRNA is expressed prior to and following viral infection. By expressing both TRAIL and its receptor, the virus-infected cell can ensure its elimination. Experiments are currently ongoing in our laboratory to determine the exact contributions of TRAIL and DR5 to SeV-induced apoptosis.
This study underscores the observation that IRF-3 engages multiple pathways in the cellular innate immune response, and it defines a novel target for IRF-3. These results highlight the important role of IRF-3 in the cellular host response to viral infection and also suggest a mechanism for virus-induced apoptosis, through the induction of TRAIL.
ACKNOWLEDGMENTS
We thank B. Mark Evers, John Hiscott, Nancy Reich, Tom Maniatis, and Keiko Ozato for providing reagents, and we are grateful to K. Münger for critical reading of the manuscript.
This work was supported by grant R01 AI42257 from the NIH to P.M.H. and by an individual NRSA fellowship (F32 CA 0936328) to J.R.K.
REFERENCES
Almasan, A., and A. Ashkenazi. 2003. Apo2L/TRAIL: apoptosis signaling, biology, and potential for cancer therapy. Cytokine Growth Factor Rev. 14:337-348.
Baetu, T. M., and J. Hiscott. 2002. On the TRAIL to apoptosis. Cytokine Growth Factor Rev. 13:199-207.
Baetu, T. M., H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott. 2001. Disruption of NF-B signaling reveals a novel role for NF-B in the regulation of TNF-related apoptosis-inducing ligand expression. J. Immunol. 167:3164-3173.
Benedict, C. A., T. A. Banks, and C. F. Ware. 2003. Death and survival: viral regulation of TNF signaling pathways. Curr. Opin. Immunol. 15:59-65.
Bovolenta, C., P. H. Driggers, M. S. Marks, J. A. Medin, A. D. Politis, S. N. Vogel, D. E. Levy, K. Sakaguchi, E. Appella, J. E. Coligan, and K. Ozato. 1994. Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family. Proc. Natl. Acad. Sci. USA 91:5046-5050.
Clarke, N., A. M. Jimenez-Lara, E. Voltz, and H. Gronemeyer. 2004. Tumor suppressor IRF-1 mediates retinoid and interferon anticancer signaling to death ligand TRAIL. EMBO J. 23:3051-3060.
Clarke, P., S. M. Meintzer, S. Gibson, C. Widmann, T. P. Garrington, G. L. Johnson, and K. L. Tyler. 2000. Reovirus-induced apoptosis is mediated by TRAIL. J. Virol. 74:8135-8139.
Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. I and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491-496.
Gong, B., and A. Almasan. 2000. Genomic organization and transcriptional regulation of human Apo2/TRAIL gene. Biochem. Biophys. Res. Commun. 278:747-752.
Heylbroeck, C., S. Balachandran, M. J. Servant, C. DeLuca, G. N. Barber, R. Lin, and J. Hiscott. 2000. The IRF-3 transcription factor mediates Sendai virus-induced apoptosis. J. Virol. 74:3781-3792.
Hiscott, J., P. Pitha, P. Genin, H. Nguyen, C. Heylbroeck, Y. Mamane, M. Algarte, and R. Lin. 1999. Triggering the interferon response: the role of IRF-3 transcription factor. J. Interferon Cytokine Res. 19:1-13.
Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451-1460.
Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, and J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19:959-966.
Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996.
Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, R. Lin, and J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1-14.
Ozoren, N., and W. S. El-Deiry. 2003. Cell surface death receptor signaling in normal and cancer cells. Semin. Cancer Biol. 13:135-147.
Park, S. Y., J. W. Seol, Y. J. Lee, J. H. Cho, H. S. Kang, I. S. Kim, S. H. Park, T. H. Kim, J. H. Yim, M. Kim, T. R. Billiar, and D. W. Seol. 2004. IFN- enhances TRAIL-induced apoptosis through IRF-1. Eur. J. Biochem. 271:4222-4228.
Ronco, L. V., A. Y. Karpova, M. Vidal, and P. M. Howley. 1998. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev. 12:2061-2072.
Sato, K., S. Hida, H. Takayanagi, T. Yokochi, N. Kayagaki, K. Takeda, H. Yagita, K. Okumura, N. Tanaka, T. Taniguchi, and K. Ogasawara. 2001. Antiviral response by natural killer cells through TRAIL gene induction by IFN-/?. Eur. J. Immunol. 31:3138-3146.
Sedger, L. M., D. M. Shows, R. A. Blanton, J. J. Peschon, R. G. Goodwin, D. Cosman, and S. R. Wiley. 1999. IFN- mediates a novel antiviral activity through dynamic modulation of TRAIL and TRAIL receptor expression. J. Immunol. 163:920-926.
Servant, M. J., B. ten Oever, C. LePage, L. Conti, S. Gessani, I. Julkunen, R. Lin, and J. Hiscott. 2001. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J. Biol. Chem. 276:355-363.
Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003. Triggering the interferon antiviral response through an I-related pathway. Science 300:1148-1151.
Tanaka, N., M. Sato, M. S. Lamphier, H. Nozawa, E. Oda, S. Noguchi, R. D. Schreiber, Y. Tsujimoto, and T. Taniguchi. 1998. Type I interferons are essential mediators of apoptotic death in virally infected cells. Genes Cells 3:29-37.
Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. Irf family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623-655.
Thanos, D., and T. Maniatis. 1995. Virus induction of human IFN-? gene expression requires the assembly of an enhanceosome. Cell 83:1091-1100.
Wang, Q., Y. Ji, X. Wang, and B. M. Evers. 2000. Isolation and molecular characterization of the 5'-upstream region of the human TRAIL gene. Biochem. Biophys. Res. Commun. 276:466-471.
Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-? enhancer in vivo. Mol. Cell 1:507-518.
Weaver, B. K., O. Ando, K. P. Kumar, and N. C. Reich. 2001. Apoptosis is promoted by the dsRNA-activated factor (DRAF1) during viral infection independent of the action of interferon or p53. FASEB J. 15:501-515.(Jessica R. Kirshner, Alla)
ABSTRACT
Interferon production and apoptosis in virus-infected cells are necessary to prevent progeny virus production and to eliminate infected cells. Paramyxovirus infection induces apoptosis through interferon regulatory factor 3 (IRF-3), but the exact mechanism of how IRF-3 functions is unknown. We show that IRF-3 is involved in the transcriptional induction of TRAIL, a key player in the apoptosis pathway. IRF-3 upregulates TRAIL transcription following viral infection and binds an interferon-stimulated response element in the TRAIL promoter. The mRNA for TRAIL and its receptor, DR5, are induced following viral infection. These studies identify TRAIL as a novel IRF-3 transcriptional target.
TEXT
Viral infection results in a swift innate cellular response against potential lytic infection, transformation and/or apoptosis, which is characterized by the production of alpha interferon (IFN-) and IFN-?. This signaling results in activation of IFN-stimulated genes (ISGs) that mediate the effects of IFN. IFN regulatory factors (IRFs) are a family of nine cellular factors that bind to consensus IFN-stimulated response elements (ISREs) and induce other ISGs (15, 24).
IRF-3 is unique among IRFs because it is constitutively expressed and is posttranslationally activated immediately following infection by several classes of viruses (11, 27). Upon viral infection, Tank binding kinase 1 and I kinase 1 (8, 22) phosphorylate the C-terminal residues required for activation of cytoplasmic IRF-3 (14, 21). IRF-3 then translocates to the nucleus, where it potentiates a transcription complex composed of CREB binding protein or p300, ATF/c-jun, and NFB, activating the transcription of IFN-? (10, 14, 27).
Infection by many viruses leads to apoptosis by two major pathways that initiate downstream of a death signal; however, the mechanism that triggers programmed cell death is not completely understood. Type I IFNs have been implicated as essential mediators of apoptosis (23); however, cell death after viral infection can also be initiated independently of IFN (28). Overexpression of a constitutively active IRF-3 mutant leads to apoptosis in Jurkat and 293 cells, and expression of wild-type IRF-3 can augment virus-induced apoptosis (10). Interestingly, the role of IRF-3 in virus-induced apoptosis was found to be both IFN and p53 independent (28). In this study, we explored the mechanism by which IRF-3 might mediate the apoptotic response to Sendai virus (SeV) infection.
SeV infection leads to transcriptional upregulation of TRAIL. Heylbroeck et al. (10) and Weaver et al. (28) have implicated caspase 8 as a downstream effector in SeV-induced apoptosis. To identify the SeV-induced apoptotic signals upstream of caspase 8, we infected both primary (human foreskin keratinocytes [HFK]) and tumor (human colonic adenocarcinoma cells [HT-29]) cell lines with SeV and analyzed mRNA expression profiles by RNase protection using probe sets for mRNAs in the tumor necrosis factor (TNF) family. Total cell mRNA was isolated at various times from control or SeV-infected cells, and the RNase protection products were resolved by polyacrylamide gel electrophoresis. Figure 1A and B show results from HFK cells. The induction of IFN-? mRNA served as a positive control (24, 25), with a strong upregulation observed at 4 h postinfection (Fig. 1B). Interestingly, for the hApo3d probe set, only the TRAIL (TNF-related apoptosis-inducing ligand) mRNA was strongly up-regulated post SeV infection at 4 h, similar to IFN-? mRNA (Fig. 1A). In addition, we noted the expression of its signaling receptor, DR5, prior to viral infection at 0 h, and that was further upregulated, albeit not to the high levels seen for TRAIL mRNA (Fig. 1A).
The cell type specificity of TRAIL mRNA upregulation was investigated by using the human colon adenocarcinoma cell line, HT-29, previously used to examine the human TRAIL promoter (9, 26). We confirmed that both TRAIL and DR5 mRNAs were upregulated at 3 h after infection (Fig. 1C). The mRNAs for the nonsignaling TRAIL receptors DcR1 and DcR2 were not upregulated in either cell type. The induction of TRAIL mRNA in both transformed and primary cell lines thus implicated TRAIL as a potential mediator of virus-induced apoptosis.
To determine whether IRF-3 might play a role in SeV-induced TRAIL expression, we performed RNase protection analysis using IRF-3-transfected cells. Previous experiments that demonstrated a role for IRF-3 in SeV-induced apoptosis had also been performed with IRF-3-transfected cells (10, 28). To avoid possible secondary effects arising from IFN signaling, HEC-1B cells (which lack the IFN receptor) (28) were transfected with either the vector control or an IRF-3 expression plasmid 24 h prior to infection with SeV. As shown in Fig. 1D, TRAIL mRNA was strongly induced in the IRF-3-transfected cells and not in the vector-transfected cells, indicating that IRF-3 contributes to SeV activation of TRAIL transcription.
IRF-3 transactivates the TRAIL promoter following SeV infection. A TRAIL luciferase reporter construct was cotransfected with plasmids expressing members of the IRF family of transcription factors into HEC-1B cells 18 h prior to SeV infection. The functionality of all expression constructs was verified using an IFN-? luciferase reporter (data not shown). In addition, two IRF-3 mutants (IRF-3 5D and IRF-3N60) were tested for the ability to transactivate the TRAIL promoter. Constitutively active IRF-3 5D contains phosphomimetic substitutions of aspartic acid in the carboxy-terminal cluster of serines and threonines (14). IRF-3 N60 lacks 60 amino acids of the DNA binding domain (IRF-3 N60) and functions in a dominant negative fashion (28). Luciferase levels were measured 16 h after SeV infection (Fig. 2). IRF-3 activated the TRAIL promoter about sevenfold after infection compared to the uninfected IRF-3-expressing cells. Neither IRF-1, IRF-2, nor IRF-7 activated the TRAIL promoter reporter (5). As anticipated, IRF-3 5D activated the TRAIL promoter whereas IRF-3 N60 inhibited transactivation of the TRAIL promoter. These data demonstrated that IRF-3 was the only IRF family member tested that could activate the –1371 TRAIL promoter.
To determine whether the TRAIL promoter contained an IRF-3 response element, we used the TRANSFAC (http://www.gene-regulation.com) internet-based transcription factor binding site program. Examination of the 1.5-kb TRAIL promoter revealed several potential consensus response elements for NFB, AP-1, NFAT, Sp1, Oct-1, and IRFs (9, 26). The locations of these elements in the TRAIL promoter are shown in Fig. 3.
In addition, previous analysis of the TRAIL promoter performed with Jurkat cells and human colon cancer cells had revealed two IFN-responsive regions that contribute to promoter activity (9, 26). Furthermore, the putative ISRE close to the start site of the TRAIL gene (from –121 to –140) is similar in sequence to the ISRE of the RANTES promoter, to which IRF-3 has been previously been shown to bind (13).
IRF-3 binds the TRAIL promoter following SeV infection in HT-29 cells. To determine whether IRF-3 binds to the upstream TRAIL ISRE identified by TRANSFAC analysis, we performed no-shift (Novagen) analysis. No-shift assays are similar to electrophoretic mobility shift assays but use an enzyme-linked immunosorbent assay-based format. We prepared nuclear extracts from HT-29 cells that were either untreated or SeV infected. Extracts were incubated with a TRAIL ISRE (5' GCTTCTTTCAGTTTCCCTCCTTTCCAACGA) or ISG15 ISRE (5' ATGCCTCGGGAAAGGGAAACCGAAACTGAAGCCA) double-stranded biotinylated oligonucleotide and transferred to a streptavidin-coated plate. Bound transcription factors were detected using IRF-3-, IRF-7-, and ISGF3-specific antibodies (Santa Cruz), followed by a secondary antibody conjugated to horseradish peroxidase. The complexes were detected by a chromogenic reaction with a tetramethylbenzidine substrate. Figure 4A and B demonstrate that IRF-3 bound both the TRAIL and ISG15 ISREs threefold and sixfold, respectively, above the background following SeV infection. No significant binding of IRF-7 or ISGF3 was observed with either oligonucleotide. An unrelated TNF--specific antibody showed no increase in signal intensity with either oligonucleotide using extract from SeV-infected cells (data not shown).
To confirm the interaction of IRF-3 with the TRAIL ISRE, we mutated nucleotides corresponding to those important for IRF-3 binding in the RANTES ISRE (13). These mutant biotinylated oligonucleotides (Mut 1, 5' TTATTTCAATTTCCCTC; Mut 2, 5' TTCTTTCAGAAACCCTCCTTT [mutated bases are underlined]) were incubated with extracts as described above. The amount of IRF-3 bound was detected with the IRF-3 monoclonal SL-12 antibody (18). Figure 4C shows an increase in signal intensity with wild-type TRAIL ISRE but not with the two mutant TRAIL ISREs.
To determine the responsiveness of IRF-3 to ISRE mutations, we constructed mutant versions of the full-length TRAIL promoter containing mutants 1 and 2. These reporters were transfected with an IRF-3 expression plasmid into HEC-1B cells, and luciferase assays were performed following SeV infection. Interestingly, the ISRE mutations significantly impaired both the basal and SeV-activated levels of the TRAIL reporters (data not shown). Thus, the mutations introduced into the TRAIL promoter ISRE may affect the interaction of cellular transcription factors involved in basal, as well as IRF-3-induced, transcription.
In this study, we have discovered that cells upregulate TRAIL in response to SeV infection and that IRF-3 regulates TRAIL at the transcriptional level, thus defining a novel transcriptional target for IRF-3. TRAIL has been shown to be part of the cellular response to infection by several viruses (for a review, see reference 4). Work by Clarke et al. (7) implicated TRAIL as a mediator of reovirus-induced apoptosis, and both TRAIL mRNA and TRAIL DR5 mRNAs are upregulated following infection by reovirus, as well as by cytomegalovirus (7, 20).
As many signaling pathways, including NFB and ATF/c-jun, are also activated following SeV infection, it is likely that TRAIL induction, like IFN-?, may result from the activation of several signaling pathways, not only IRF-3. Indeed, several potential response elements have been described within the TRAIL promoter, including those for CEBP, AP-1, GATA, NFAT, NFB, and SP-1 (9, 26) in addition to the ISREs (this study and reference 3).
TRAIL transcriptional regulation has been largely studied in cells of hematopoietic origin. The IRF family member ISGF3 is critical for the regulation of murine TRAIL in natural killer cells (19). In Jurkat T cells, NFB is a crucial regulator of TRAIL expression (3). In many other cell lines, TRAIL can be regulated by IFN-/? and IFN- and by IRF-1 (6, 12, 17). It is therefore possible that different IRFs may be able to bind to ISRE upstream elements in the TRAIL promoter, depending on the cell type.
Interestingly, TRAIL has two decoy receptors (DcR1, DcR2) preferentially expressed on normal cells and two death receptors (DR4, DR5) preferentially expressed on tumor cells (1, 2, 16). We have shown that DR5 mRNA is expressed prior to and following viral infection. By expressing both TRAIL and its receptor, the virus-infected cell can ensure its elimination. Experiments are currently ongoing in our laboratory to determine the exact contributions of TRAIL and DR5 to SeV-induced apoptosis.
This study underscores the observation that IRF-3 engages multiple pathways in the cellular innate immune response, and it defines a novel target for IRF-3. These results highlight the important role of IRF-3 in the cellular host response to viral infection and also suggest a mechanism for virus-induced apoptosis, through the induction of TRAIL.
ACKNOWLEDGMENTS
We thank B. Mark Evers, John Hiscott, Nancy Reich, Tom Maniatis, and Keiko Ozato for providing reagents, and we are grateful to K. Münger for critical reading of the manuscript.
This work was supported by grant R01 AI42257 from the NIH to P.M.H. and by an individual NRSA fellowship (F32 CA 0936328) to J.R.K.
REFERENCES
Almasan, A., and A. Ashkenazi. 2003. Apo2L/TRAIL: apoptosis signaling, biology, and potential for cancer therapy. Cytokine Growth Factor Rev. 14:337-348.
Baetu, T. M., and J. Hiscott. 2002. On the TRAIL to apoptosis. Cytokine Growth Factor Rev. 13:199-207.
Baetu, T. M., H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott. 2001. Disruption of NF-B signaling reveals a novel role for NF-B in the regulation of TNF-related apoptosis-inducing ligand expression. J. Immunol. 167:3164-3173.
Benedict, C. A., T. A. Banks, and C. F. Ware. 2003. Death and survival: viral regulation of TNF signaling pathways. Curr. Opin. Immunol. 15:59-65.
Bovolenta, C., P. H. Driggers, M. S. Marks, J. A. Medin, A. D. Politis, S. N. Vogel, D. E. Levy, K. Sakaguchi, E. Appella, J. E. Coligan, and K. Ozato. 1994. Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family. Proc. Natl. Acad. Sci. USA 91:5046-5050.
Clarke, N., A. M. Jimenez-Lara, E. Voltz, and H. Gronemeyer. 2004. Tumor suppressor IRF-1 mediates retinoid and interferon anticancer signaling to death ligand TRAIL. EMBO J. 23:3051-3060.
Clarke, P., S. M. Meintzer, S. Gibson, C. Widmann, T. P. Garrington, G. L. Johnson, and K. L. Tyler. 2000. Reovirus-induced apoptosis is mediated by TRAIL. J. Virol. 74:8135-8139.
Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. I and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491-496.
Gong, B., and A. Almasan. 2000. Genomic organization and transcriptional regulation of human Apo2/TRAIL gene. Biochem. Biophys. Res. Commun. 278:747-752.
Heylbroeck, C., S. Balachandran, M. J. Servant, C. DeLuca, G. N. Barber, R. Lin, and J. Hiscott. 2000. The IRF-3 transcription factor mediates Sendai virus-induced apoptosis. J. Virol. 74:3781-3792.
Hiscott, J., P. Pitha, P. Genin, H. Nguyen, C. Heylbroeck, Y. Mamane, M. Algarte, and R. Lin. 1999. Triggering the interferon response: the role of IRF-3 transcription factor. J. Interferon Cytokine Res. 19:1-13.
Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451-1460.
Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, and J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19:959-966.
Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996.
Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, R. Lin, and J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1-14.
Ozoren, N., and W. S. El-Deiry. 2003. Cell surface death receptor signaling in normal and cancer cells. Semin. Cancer Biol. 13:135-147.
Park, S. Y., J. W. Seol, Y. J. Lee, J. H. Cho, H. S. Kang, I. S. Kim, S. H. Park, T. H. Kim, J. H. Yim, M. Kim, T. R. Billiar, and D. W. Seol. 2004. IFN- enhances TRAIL-induced apoptosis through IRF-1. Eur. J. Biochem. 271:4222-4228.
Ronco, L. V., A. Y. Karpova, M. Vidal, and P. M. Howley. 1998. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev. 12:2061-2072.
Sato, K., S. Hida, H. Takayanagi, T. Yokochi, N. Kayagaki, K. Takeda, H. Yagita, K. Okumura, N. Tanaka, T. Taniguchi, and K. Ogasawara. 2001. Antiviral response by natural killer cells through TRAIL gene induction by IFN-/?. Eur. J. Immunol. 31:3138-3146.
Sedger, L. M., D. M. Shows, R. A. Blanton, J. J. Peschon, R. G. Goodwin, D. Cosman, and S. R. Wiley. 1999. IFN- mediates a novel antiviral activity through dynamic modulation of TRAIL and TRAIL receptor expression. J. Immunol. 163:920-926.
Servant, M. J., B. ten Oever, C. LePage, L. Conti, S. Gessani, I. Julkunen, R. Lin, and J. Hiscott. 2001. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J. Biol. Chem. 276:355-363.
Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003. Triggering the interferon antiviral response through an I-related pathway. Science 300:1148-1151.
Tanaka, N., M. Sato, M. S. Lamphier, H. Nozawa, E. Oda, S. Noguchi, R. D. Schreiber, Y. Tsujimoto, and T. Taniguchi. 1998. Type I interferons are essential mediators of apoptotic death in virally infected cells. Genes Cells 3:29-37.
Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. Irf family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623-655.
Thanos, D., and T. Maniatis. 1995. Virus induction of human IFN-? gene expression requires the assembly of an enhanceosome. Cell 83:1091-1100.
Wang, Q., Y. Ji, X. Wang, and B. M. Evers. 2000. Isolation and molecular characterization of the 5'-upstream region of the human TRAIL gene. Biochem. Biophys. Res. Commun. 276:466-471.
Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-? enhancer in vivo. Mol. Cell 1:507-518.
Weaver, B. K., O. Ando, K. P. Kumar, and N. C. Reich. 2001. Apoptosis is promoted by the dsRNA-activated factor (DRAF1) during viral infection independent of the action of interferon or p53. FASEB J. 15:501-515.(Jessica R. Kirshner, Alla)