Three Immunoproteasome-Associated Subunits Coopera
http://www.100md.com
病菌学杂志 2006年第2期
Division of Immunology, Aichi Cancer Center Research Institute, Nagoya, Japan
Department of Internal Medicine II, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan
Department of Cell Therapy, Aichi Cancer Center Hospital, Nagoya, Japan
ABSTRACT
The precise roles of gamma interferon-inducible immunoproteasome-associated molecules in generation of cytotoxic T-lymphocyte (CTL) epitopes have yet to be fully elucidated. We describe here a unique epitope derived from the Epstein-Barr virus (EBV) latent membrane protein 2A (LMP2A) presented by HLA-A2402 molecules. Generation of the epitope, designated LMP2A222-230, from the full-length protein requires the immunoproteasome subunit low-molecular-weight protein 7 (ip-LMP7) and the proteasome activator 28- subunit and is accelerated by ip-LMP2, as revealed by gene expression experiments using an LMP2A222-230-specific CTL clone as a responder in enzyme-linked immunospot assays. The unequivocal involvement of all three components was confirmed by RNA interference gene silencing. Interestingly, the LMP2A222-230 epitope could be efficiently generated from incomplete EBV-LMP2A fragments that were produced by puromycin treatment or gene-engineered shortened EBV-LMP2A lacking some of its hydrophobic domains. In addition, epitope generation was increased by a single amino acid substitution from leucine to alanine immediately flanking the C terminus, this being predicted by a web-accessible program to increase the cleavage strength. Taken together, the data indicate that the generation of LMP2A222-230 is influenced not only by extrinsic factors such as immunoproteasomes but also by intrinsic factors such as the length of the EBV-LMP2A protein and proteasomal cleavage strength at specific positions in the source antigen.
INTRODUCTION
Cytotoxic T lymphocytes (CTLs) recognize short peptide products processed from target proteins and presented by major histocompatibility complex (MHC) class I molecules. The first step in protein processing in the cytosol is cleavage by proteasomes, proteolytic complexes playing a critical role in the antigen processing pathway. Resultant peptides are translocated by the transporters associated with antigen processing into the endoplasmic reticulum, where they assemble with newly synthesized MHC class I molecules for transportation to the cell surface (12, 28, 33). Proteasome catalytic activity is exerted by the 20S core proteasome, a cylindrical structure composed of four stacked rings. The outer two rings consist of seven different subunits, and the inner rings consist of seven different -type subunits. Enzymatic activity is mediated by three of the subunits, designated 1 (Y/), 2 (Z/MC14), and 5 (X/MB1) (33). Exposure of cells to gamma interferon (IFN-) during immune responses alters the proteasome activity qualitatively and quantitatively with the induction of three newly synthesized immunoproteasome subunits, low-molecular-weight protein 2 (ip-LMP2) or 1i, multicatalytic endopeptidase complex-like 1 (MECL-1) or 2i, and ip-LMP7 or 5i. These become incorporated interdependently and replace the three constitutive subunits in newly assembled immunoproteasomes (14, 22, 24). The expression of ip-LMP7 and/or ip-LMP2 is known to alter the proteasomal cleavage specificity for virus- and tumor-associated antigens (15, 39). Furthermore, the incorporation of ip-LMP7 is sufficient to alter cleavage properties of proteasomes although the role of its catalytic site remains unclear (8, 36, 38, 40). The expression of ip-LMP2 alone or with ip-LMP7 is also reported to change cleavage specificity (1, 19, 23), and effects of the two subunits have been observed in each subunit's knockout mice (4, 7, 45).
Besides its effects on immunoproteasomes, IFN- up-regulates expression of the proteasome activator 28 (PA28), which consists of two different subunits, and , that form a heptameric ring that binds to proteasomes and is thought to increase their rate of cleavage (39). Regarding contributions to epitope liberation, effects of the subunit have been observed (10, 41) but findings are limited regarding the subunit (41). Elucidating differential effects of the three immunoproteasome subunits and two PA28 subunits is clearly important for a better understanding of generation of CTL epitopes.
Recently, defective ribosomal products (DRiPs) from newly synthesized proteins, which are rapidly ubiquitylated and degraded by proteasomes, were shown to be the main sources of antigenic peptides (29, 35, 48, 49); this suggests that antigen structures are critical for efficient processing by proteasomes. While almost every amino acid residue can serve as a cleavage site, there are certain preferences (25, 27, 44). Because the C terminus of the CTL epitope is precisely determined by the proteasome, cleavage strength at specific positions, such as that immediately flanking the C terminus of the epitope, really affects epitope generation (14, 34). In fact, mutation in the flanking region of epitopes has been shown to impair the processing by proteasomes (2, 37). Thus, structural features play an important role in epitope liberation and could influence the working of the five immunoproteasome-associated subunits.
We have previously shown the generation of an HLA-A2402-restriced CTL epitope in the Epstein-Barr virus (EBV) latent membrane protein 2A (EBV-LMP2A), amino acids 222 to 230 (referred to as LMP2A222-230), to be dependent on IFN- exposure (18). Differential expression of ip-LMP2, MECL-1, ip-LMP7, PA28, and PA28 in various combinations has allowed us to selectively address the role of each subunit in the processing of the epitope independently of other IFN--inducible proteins, and we have established that the generation of LMP2A222-230 is cooperatively controlled by interplay among ip-LMP2, ip-LMP7, and PA28. Moreover, these observations were supported by the results of RNA interference experiments. We have now extended our studies to demonstrate that LMP2A structural factors influence epitope liberation in various target cells.
MATERIALS AND METHODS
CTL clones and epitopes. EBV-specific CTL lines and clones were established as described earlier (18). Briefly, EBV-specific T-cell lines were generated from peripheral blood mononuclear cells after stimulation with HLA-A2402-transfected, TAP-negative T2-A24 cells (18) pulsed with each epitope peptide or autologous EBV-carrying lymphoblastoid cell lines (LCLs). After several rounds of stimulation, CTL clones were established by a limiting dilution method. A polyclonal CTL line that was specific to the epitope LMP2A419-427 (TYGPVFMCL) (21) was designated LMP2A419-427-CTL, and CTL clones that were specific to the epitope LMP2A222-230 (IYVLVMLVL) (18) were designated LMP2A222-230-CTL.
Cell lines. T2-A24 cells were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin, and 800 μg/ml of G418 (Invitrogen Corp., Carlsbad, CA). HLA-A2402-positive LCLs and PT67 cells (BD Bioscience Clontech, Palo Alto, CA), retroviral packaging cell lines, were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin, and 50 μg/ml of kanamycin (referred to as LCL medium). HLA-A2402-positive LCLs expressing short hairpin RNA (shRNA) were maintained in LCL medium in the presence of 0.8 μg/ml of puromycin. HEK293 T cells (referred to as 293T; American Type Culture Collection, Manassas, VA) and HLA-A2402-positive dermal fibroblast cell lines were cultured in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin.
Expression vectors. Plasmids expressing various lengths of EBV-LMP2A and EBNA3A, from full-length proteins to minimal epitopes, were constructed as described previously (16, 18). Full-length HLA-A2402, ip-LMP2, ip-LMP7, MECL-1, PA28, and PA28 were amplified by reverse transcriptase (RT)-PCR from HLA-A2402-positive LCLs, cloned into the pcDNA3.1(+) vector (Invitrogen Corp.), and sequenced. A plasmid containing a mutant EBV-LMP2A gene with alanine substituted for leucine at position 231 was constructed by PCR-based mutagenesis as described previously (16). This single amino acid substitution was intended to increase the proteasome cleavage strength, as predicted with the Prediction Algorithm for Proteasomal Cleavages I program (PAProC version 1.0; http://www.paproc.de/) (17, 26).
Transduction of 293T cells. The plasmids encoding HLA-A2402 and EBV-LMP2A and at least one of those expressing ip-LMP2, ip-LMP7, MECL-1, PA28, or PA28 were transfected into 293T cells using TransIT-293 transfection reagents (Mirus, Madison, WI). Briefly, 3 x 104 cells were transfected with 100 ng of each plasmid and 0.2 μl TransIT reagent per 100 ng DNA in various combinations in 96-well plates. After 24 h, these cells were used as stimulators in the enzyme-linked immunospot (ELISPOT) assay.
shRNA interference retrovirus vectors. The following small interfering RNA targets were selected in this study: ip-LMP2, AAGUGAAGGAGGUCAGGUAUA; ip-LMP7, AGAUUAACCCUUACCUGCUTT; and PA28, AAGCCAACUUGAGCAAUCUGA. shRNA constructs included a TTCAAGAGA-loop separating the sense and antisense sequences followed by a 5T termination signal. These constructs were synthesized as two cDNA oligonucleotides, annealed, and ligated between the BamHI and EcoRI sites of the RNAi-Ready pSIREN-RetroQ vector (BD Biosciences Clontech). In addition, oligonucleotides with sequences selected by the company (BD Biosciences Clontech) as a negative control for gene silencing were annealed and inserted into the same vector.
Retrovirus production and infection. PT67 cells were plated on six-well culture plates, and a 4-μg aliquot of each retrovirus vector plasmid was transfected with Lipofectamine 2000 (Invitrogen Corp), according to the manufacturer's instructions. After culture in the presence of 2.5 μg/ml of puromycin for 14 days, the cells were incubated in medium without puromycin for another 48 h. The culture supernatant was collected, and debris was removed by centrifugation at 1,000 x g for 10 min. A total of 1 x 106 LCLs were suspended in 1 ml of the virus-containing culture supernatant in each well of a 12-well plate, and polybrene was added to a final concentration of 10 μg/ml. Plates were centrifuged at 1,000 x g at 32°C for 1 h and incubated at 37°C in a humidified incubator. The LCLs were then cultured in medium containing puromycin for 14 days. Expression of ip-LMP2, ip-LMP7, or PA28 in these LCLs was analyzed by Western blotting and RT-PCR for gene silencing.
Western blotting. Western blotting was performed as described previously with slight modifications (42). Briefly, aliquots of 130 μg protein were applied to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis, blotted onto Immobilon-P membranes (Millipore Corporation, Bedford, MA), blocked with phosphate-buffered saline containing 10% low-fat dry milk and 0.1% Tween 20 overnight at 4°C, and probed with rabbit polyclonal antibodies specific to ip-LMP2, ip-LMP7, and PA28 (Affinity, Mamhead, United Kingdom), followed by peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed, San Francisco, CA). Proteins were visualized using an ECL Western blot detection system (Amersham Biosciences, Buckinghamshire, United Kingdom).
RT-PCR. Total RNA was extracted from LCLs and reverse transcription was performed in 20-μl reactions containing random hexamers and 1-μg aliquots. The specific primer sets used to detect ip-LMP2, ip-LMP7, and PA28 were as follows: ip-LMP2 forward, 5'-GGTGGTGAACCGAGTGTTTGA-3'; ip-LMP2 reverse, 5'-GCCAAAACAAGTGGAGGTTCC-3'; ip-LMP7 forward, 5'-GATTGCAGCAGTGGATTCTCG-3'; ip-LMP7 reverse, 5'-GACATGGTGCCAAGCAGGTAA-3'; PA28 forward, 5'-ACCAAGACAGAGAACCTGCTCG-3'; and PA28 reverse, 5'-GGCCTTCAGATTGCTCAAGTTG-3'.
ELISPOT assays. ELISPOT assays were performed as previously described (18). In brief, a MultiScreen-HA plate (Millipore) was coated with anti-human IFN- monoclonal antibody (Endogen, Rockford, IL) and used as the assay plate. The following stimulator cells in 100 μl of LCL medium were seeded into the wells: (i) 293T cells cotransfected with plasmids expressing HLA-A2402 and those expressing various lengths of EBV-LMP2A (in some experiments, cells were treated with puromycin at 1 μg/ml for 30 min); (ii) 293T cells cotransfected with plasmids encoding HLA-A2402 and EBV-LMP2A and at least one of those two expressing ip-LMP2, ip-LMP7, MECL-1, PA28, or PA28b; and (iii) LCLs transduced by retrovirus vectors expressing shRNA for either ip-LMP2, ip-LMP7, or PA28a.
LMP2A222-230-CTLs or LMP2A419-427-CTLs in 100 μl medium were introduced into each well and incubated for 20 h. To visualize spots, anti-human IFN- polyclonal antibody (Endogen), horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed) and substrate were used. All assays were performed in duplicate.
RESULTS
LMP2A222-230 is not presented on target cells expressing full-length EBV-LMP2A. The LMP2A419-427-CTL responded to 293T cells pulsed with the epitope peptide and to those expressing full-length EBV-LMP2A cotransfected with HLA-A2402. However, the LMP2A222-230-CTL responded to 293T cells expressing the minimal epitope, but not full-length EBV-LMP2A, cotransfected with HLA-A2402 (Fig. 1).
As we reported previously, IFN--treated fibroblasts transduced with full-length EBV-LMP2A were recognized by LMP2A222-230-CTL, showing LMP2A222-230 to be an IFN--dependent epitope. This suggested that IFN--induced immunoproteasome and PA28 subunits generate LMP2A222-230 in the target cells (18).
Generation of LMP2A222-230 requires the immunoproteasome subunit ip-LMP7 and PA28 and is enhanced by ip-LMP2. To investigate whether immunoproteasome-associated molecules are involved in generating the LMP2A222-230 epitope, we examined the effect of each proteasome immunosubunit (ip-LMP2, ip-LMP7, and MECL-1) and PA28 subunit (PA28 and PA28) in 293T cells that dominantly have a standard proteasome. First, 293T cells were cotransfected with plasmids encoding HLA-A2402, the full-length EBV-LMP2A, and immunoproteasome-associated molecules in various combinations, as shown in Fig. 2A. We then evaluated epitope liberation using the ELISPOT assay. Surprisingly, three molecules were found to be involved in the generation of LMP2A222-230: ip-LMP7 and PA28 subunits were required, and the ip-LMP2 subunit enhanced its recognition (Fig. 2A). We confirmed the expression of ip-LMP2, ip-LMP7, and PA28 by Western blotting (Fig. 2B).
Inhibition of ip-LMP2, ip-LMP7, and PA28 expression in LCLs by RNA interference decreases the generation of LMP2A222-230 in target cells. LCLs predominantly have immunoproteasomes (24), and the LMP2A222-230-CTL have recognized HLA-A2402-positive LCLs, as we reported previously (18). To examine whether ip-LMP2, ip-LMP7, or PA28 is most directly involved in the generation of LMP2A222-230, we evaluated the epitope liberation in LCLs in which the expression of each subunit was separately inhibited using a gene-silencing technique. HLA-A2402-positive LCLs were infected with retrovirus vectors expressing shRNAs for ip-LMP2, ip-LMP7, or PA28 and assessed for the expression of each subunit by Western blotting (Fig. 3A, B, and C) and RT-PCR (data not shown). Then, generation of the LMP2A222-230 epitope was probed with epitope-specific CTL using the ELISPOT assay. As expected, epitope liberation was clearly decreased with the inhibition of ip-LMP2, ip-LMP7, or PA28 expression (Fig. 3A, B, and C), demonstrating definitive involvement of all three molecules in the generation of LMP2A222-230. To test whether the generation of IFN--independent EBV-LMP2 epitope was influenced in these LCLs transfected with shRNA expression vectors for ip-LMP2, ip-LMP7, or PA28, we investigated the generation of LMP2A419-427 using the ELISPOT assay. We found that there were no significant differences in the processing of this epitope. (data not shown).
Incomplete or shortened EBV-LMP2A results in efficient generation of LMP2A222-230 in target cells. Recently, DRiPs have been reported to be major sources of CTL epitopes (43, 46), suggesting that incomplete antigen proteins allow efficient processing. To test this possibility with regard to LMP2A222-230, 293T cells transduced with HLA-A2402 and full-length EBV-LMP2A together with ip-LMP7 and/or PA28 were treated with puromycin for 30 min to generate short-lived premature proteins (6, 13, 47). We then analyzed the generation of LMP2A222-230 by ELISPOT assay. As shown in Fig. 4A, puromycin treatment remarkably augmented LMP2A222-230-CTL recognition on the cells expressing ip-LMP7 and PA28. Interestingly, puromycin was capable of substituting either effect of ip-LMP7 and PA28.
Next, we introduced truncated EBV-LMP2A of different lengths starting from isoleucine at position 222, the first amino acid of LMP2A222-230, into expression vectors (Fig. 4B). The generation of LMP2A222-230 was studied in 293T cells cotransfected with vectors encoding HLA-A2402 and each truncated EBV-LMP2A without immunoproteasomes and PA28 subunits. Interestingly, the shortest EBV-LMP2A antigen was processed most efficiently and all truncated EBV-LMP2A antigens could be processed to generate LMP2A222-230 without the aid of immunoproteasomes and PA28 (Fig. 4C). These data clearly demonstrated that the efficiency of LMP2A222-230 generation is, at least in part, dependent on the length of the source protein.
Substitution of amino acid immediately flanking the C terminus of LMP2A222-230, increasing the proteasome cleavage strength, results in efficient generation of LMP2A222-230 in target cells. Finally, we investigated whether the amino acid cleavage strength at a specific position affects the processing of the LMP2A222-230 epitope. To determine the cleavage strength of each amino acid in EBV-LMP2A, the program PAProC was used (http://www.paproc.de/). We focused on the cleavage strength, which is critical for epitope generation, of amino acids in the position immediately flanking the C termini of CTL epitopes (14, 34). First, we constructed a plasmid containing a mutant full-length LMP2A gene in which alanine replaced leucine at position 231; this was predicted to increase the cleavage strength after leucine at position 230, i.e., the C terminus of LMP2A222-230 (Fig. 5A). It was thought that this change would facilitate LMP2A222-230 generation by proteasomes. Target 293T cells were cotransfected with vectors encoding HLA-A2402, ip-LMP7, PA28, and the mutant EBV-LMP2A, and LMP2A222-230-CTL recognition was evaluated using the ELISPOT assay. A remarkable increase was evident for cells expressing ip-LMP7 and PA28 (Fig. 5B), suggesting the processing of LMP2A222-230 to be accelerated by the amino acid substitution at the specific position in the EBV-LMP2A antigen.
DISCUSSION
IFN- induces cells to express the proteasome subunits ip-LMP2, MECL-1, and ip-LMP7, leading to the formation of immunoproteasomes and the proteasome activator subunits PA28 and PA28, comprising the activator complex. Early experiments with IFN--treated cells demonstrated the generation of a number of epitopes to be affected by immunoproteasomes and PA28 (15, 32, 44). Immunoproteasomes have various cleavage site preferences as well as cleavage rates for the generation of some epitopes, while PA28 up-regulates epitope liberation via conformational changes within the proteasome 20S complex. Following the discovery that the influenza virus matrix-derived epitope required ip-LMP7 expression for its generation (3), the involvement of immunoproteasomes and PA28 subunits with different CTL epitopes received much attention. The results of the studies that investigated the effect of at least two immunoproteasome-associated molecules in the generation of CTL epitopes are summarized in Table 1 (1, 8, 10, 19, 23, 36, 38, 40, 41). The combination patterns of the five immunoproteasome-associated subunits fall into three categories. (i) PA28 alone, (ii) ip-LMP7 alone, and (iii) both ip-LMP2 and ip-LMP7 exerted the epitope generation. It has been hypothesized that immunoproteasomes and PA28 cooperate in antigen processing, but direct experimental evidence has hitherto been lacking. In this study, we found that the LMP2A222-230 epitope has two unique features. First, coexpression of ip-LMP7 and one PA28 subunit is necessary for its generation. Second, ip-LMP2 has additional effects on epitope liberation. These data suggest that the processing of an IFN--inducible epitope is controlled differentially by multiple immunoproteasome-associated subunits. To our best knowledge, this is the first documentation of molecular evidence of such cooperation.
Incorporation of the immunoproteasome is reported to be cooperative. The ip-LMP7 is required for immunoproteasome formation and maturation (9, 14). MECL-1 is incorporated if ip-LMP2 is present, while MECL-1 dependency for the incorporation of ip-LMP2 is under dispute (5, 11). Moreover, this cooperativity in forming proteasome complexes results in altered cleavage properties. In the present study, the generation of LMP2A222-230 is enhanced by ip-LMP2 expression. This effect may be exerted through the functions of ip-LMP7 and PA28, which induce the cleavages properties on the epitope generation.
In this study, we developed a retrovirus vector producing shRNA to confirm the effects of ip-LMP2, ip-LMP7, and PA28 in the generation of LMP2A222-230. Generally, the use of chemically synthesized small interfering RNA or expression plasmids for shRNA is a more feasible way to test the involvement of target molecules but we believe that the retrovirus system has advantages in our case, because the effects of RNA interference in the target cells proved stable. After an epitope binds to MHC molecules and is presented on the cell surface, the complex exists for some time. Since there is a wide range in the life spans of the MHC-epitope complex, it is difficult to infer the sufficient duration to maintain inhibition of immunoproteasome-associated subunits to examine their effects in peptide liberation. In our retrovirus system, LCLs were cultured in medium containing puromycin for 14 days after retrovirus vector infection, and we assessed LMP2A222-230 presentation on the surface. This procedure should exclude false-positive results that are observed with the ELISPOT assay.
DRiPs are thought to be important sources of CTL epitopes (29, 35, 49), as in the case of EBNA1, for example, for which epitopes are not readily generated from stable mature EBNA1 because of the glycine-alanine repeat domain within the protein (43, 46). EBV-LMP2A has 12 hydrophobic integral membrane sequences, and this hydrophobic-rich structure may inhibit epitope liberation (20). To address the question of whether the incomplete EBV-LMP2A might be superior to the mature complete EBV-LMP2A for epitope generation, we treated target cells with puromycin, which generates short-lived premature termination products from newly synthesized proteins (6, 13, 47). Interestingly, LMP2A222-230 production was accelerated in puromycin-treated 293T cells expressing ip-LMP7 or PA28, in contrast to the limited yield without puromycin treatment, even when the subunits were coexpressed. The data suggest that puromycin treatment is not sufficient to generate LMP2A222-230 epitopes via constitutive proteasomes, but rather affects epitope generation by enhancing the effect of ip-LMP7 and PA28. Next, we expressed a panel of shorter EBV-LMP2A fragments encompassing LMP2A222-230 in target cells and compared their recognition to that of LMP2A222-230-CTL. Each fragment started from the N terminus of LMP2A222-230, as shown in Fig. 4B. This strategy should focus on the cleavage efficiency of the C- terminal side, which is performed exclusively by proteasomes (14, 34). We found that shorter EBV-LMP2A fragments were processed more efficiently. Therefore, the length of the source antigen may be a critical factor. Addition of two consecutive hydrophobic transmembrane domains substantially abrogated the epitope presentation. The obstacles presented by the intrinsic structure of EBV-LMP2A may be overcome by the effects of ip-LMP7 and PA28 in the generation of the LMP2A222-230 epitope.
The cleavage efficiency at each amino acid varies widely in antigen proteins (25, 27, 44), and this may explain why one epitope is generated efficiently by proteasomes while another is not, even when processed from the same protein. Previous work showed that even a single amino acid substitution of asparagine for the aspartic acid immediately flanking the C terminus of the Moloney murine leukemia virus epitope SSWDFITV resulted in its abrogation (2). The program PAProC predicts that the cleavage strength of the C- terminal leucine in EBV-LMP2A is weak (17, 26), and substitution of an amino acid to increase the cleavage strength (from "+" to "++", as shown in Fig. 5A) resulted in remarkable up-regulation of LMP2A222-230 liberation in cells expressing ip-LMP7 and PA28.
EBV-LMP2A is thought to be an important antigen in EBV-related malignancies and is targeted by CTLs that recognize multiple epitopes located throughout the membrane-spanning molecules (20, 30, 31). Interestingly, EBV-LMP2A epitopes can be divided into two groups: (i) hydrophobic examples located in the transmembrane domain and processed in a TAP-independent manner and (ii) intertransmembrane hydrophilic epitopes, which are TAP-dependent (20). In addition, the generation of one hydrophobic epitope, LMP2A356-364, requires ip-LMP7 and ip-LMP2 (19). Moreover, we here demonstrated that the processing of LMP2A222-230 requires immunoproteasome subunits ip-LMP7 and PA28 and is enhanced by immunoproteasome subunit ip-LMP2. These two epitopes belong to the former group, although the effects of immunoproteasome and PA28 subunits on other epitopes remain to be investigated. Potentially, EBV-LMP2A is a good model for determining the mechanisms by which immunoproteasomes and PA28 affect CTL epitope generation.
In conclusion, the present investigation provided evidence for differential roles of ip-LMP2, ip-LMP7, and PA28 in the generation of the LMP2A222-230 epitope, which was most efficiently generated from incomplete EBV-LMP2A fragments and a mutated LMP2A gene with improved cleavage characteristics in cells expressing ip-LMP7 and PA28. Although the precise function of each of the three subunits could not be clarified, we showed the generation of LMP2A222-230 to be controlled by multiple factors. Further investigations on the differential effects of immunoproteasome-associated subunits could provide important information for understanding the presentation of viral and tumor antigens for CTL recognition.
ACKNOWLEDGMENTS
We thank K. Nishida and F. Ando for technical expertise and H. Tamaki and Y. Matsudaira for secretarial assistance.
This work was supported in part by Grants-in-Aid for Scientific Research (C) (no. 17590428) and the Encouragement of Young Scientists (B) (no. 16790281) from the Japan Society for the Promotion of Science, Scientific Research on Priority Areas (no. 17016090) from the Ministry of Education, Culture, Science, Sports, and Technology of Japan and the Third Team Comprehensive Control Research for Cancer (no. 30) from the Ministry of Health, Labor, and Welfare of Japan.
REFERENCES
Basler, M., N. Youhnovski, M. van den Broek, M. Przybylski, and M. Groettrup. 2004. Immunoproteasomes down-regulate presentation of a subdominant T cell epitope from lymphocytic choriomeningitis virus. J. Immunol. 173:3925-3934.
Beekman, N. J., P. A. van Veelen, T. van Hall, A. Neisig, A. Sijts, M. Camps, P. M. Kloetzel, J. J. Neefjes, C. J. Melief, and F. Ossendorp. 2000. Abrogation of CTL epitope processing by single amino acid substitution flanking the C-terminal proteasome cleavage site. J. Immunol. 164:1898-1905.
Cerundolo, V., A. Kelly, T. Elliott, J. Trowsdale, and A. Townsend. 1995. Genes encoded in the major histocompatibility complex affecting the generation of peptides for TAP transport. Eur. J. Immunol. 25:554-562.
Chen, W., C. C. Norbury, Y. Cho, J. W. Yewdell, and J. R. Bennink. 2001. Immunoproteasomes shape immunodominance hierarchies of antiviral CD8+ T cells at the levels of T cell repertoire and presentation of viral antigens. J. Exp. Med. 193:1319-1326.
De, M., K. Jayarapu, L. Elenich, J. J. Monaco, R. A. Colbert, and T. A. Griffin. 2003. 2 subunit propeptides influence cooperative proteasome assembly. J. Biol. Chem. 278:6153-6159.
Eggers, D. K., W. J. Welch, and W. J. Hansen. 1997. Complexes between nascent polypeptides and their molecular chaperones in the cytosol of mammalian cells. Mol. Biol. Cell 8:1559-1573.
Fehling, H. J., W. Swat, C. Laplace, R. Kuhn, K. Rajewsky, U. Muller, and H. von Boehmer. 1994. MHC class I expression in mice lacking the proteasome subunit LMP-7. Science 265:1234-1237.
Gileadi, U., H. T. Moins-Teisserenc, I. Correa, B. L. Booth, Jr., P. R. Dunbar, A. K. Sewell, J. Trowsdale, R. E. Phillips, and V. Cerundolo. 1999. Generation of an immunodominant CTL epitope is affected by proteasome subunit composition and stability of the antigenic protein. J. Immunol. 163:6045-6052.
Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. V. Kaer, J. J. Monaco, and R. A. Colbert. 1998. Immunoproteasome assembly: cooperative incorporation of interferon (IFN-)-inducible subunits. J. Exp. Med. 187:97-104.
Groettrup, M., A. Soza, M. Eggers, L. Kuehn, T. P. Dick, H. Schild, H. G. Rammensee, U. H. Koszinowski, and P. M. Kloetzel. 1996. A role for the proteasome regulator PA28 in antigen presentation. Nature 381:166-168.
Groettrup, M., S. Standera, R. Stohwasser, and P. M. Kloetzel. 1997. The subunits MECL-1 and LMP2 are mutually required for incorporation into the 20S proteasome. Proc. Natl. Acad. Sci. USA 94:8970-8975.
Heemels, M. T., and H. Ploegh. 1995. Generation, translocation, and presentation of MHC class I-restricted peptides. Annu. Rev. Biochem. 64:463-491.
Hightower, L. E. 1980. Cultured animal cells exposed to amino acid analogues or puromycin rapidly synthesize several polypeptides. J. Cell. Physiol. 102:407-427.
Kloetzel, P. M. 2001. Antigen processing by the proteasome. Nat. Rev. Mol. Cell Biol. 2:179-187.
Kloetzel, P. M. 2004. Generation of major histocompatibility complex class I antigens: functional interplay between proteasomes and TPPII. Nat. Immunol. 5:661-669.
Kondo, E., Y. Akatsuka, K. Kuzushima, K. Tsujimura, S. Asakura, K. Tajima, Y. Kagami, Y. Kodera, M. Tanimoto, Y. Morishima, and T. Takahashi. 2004. Identification of novel CTL epitopes of CMV-pp65 presented by a variety of HLA alleles. Blood 103:630-638.
Kuttler, C., A. K. Nussbaum, T. P. Dick, H. G. Rammensee, H. Schild, and K. P. Hadeler. 2000. An algorithm for the prediction of proteasomal cleavages. J. Mol. Biol. 298:417-429.
Kuzushima, K., N. Hayashi, A. Kudoh, Y. Akatsuka, K. Tsujimura, Y. Morishima, and T. Tsurumi. 2003. Tetramer-assisted identification and characterization of epitopes recognized by HLA A2402-restricted Epstein-Barr virus-specific CD8+ T cells. Blood 101:1460-1468.
Lautscham, G., T. Haigh, S. Mayrhofer, G. Taylor, D. Croom-Carter, A. Leese, S. Gadola, V. Cerundolo, A. Rickinson, and N. Blake. 2003. Identification of a TAP-independent, immunoproteasome-dependent CD8+ T-cell epitope in Epstein-Barr virus latent membrane protein 2. J. Virol. 77:2757-2761.
Lautscham, G., S. Mayrhofer, G. Taylor, T. Haigh, A. Leese, A. Rickinson, and N. Blake. 2001. Processing of a multiple membrane spanning Epstein-Barr virus protein for CD8+ T cell recognition reveals a proteasome-dependent, transporter associated with antigen processing-independent pathway. J. Exp. Med. 194:1053-1068.
Lee, S. P., R. J. Tierney, W. A. Thomas, J. M. Brooks, and A. B. Rickinson. 1997. Conserved CTL epitopes within EBV latent membrane protein 2: a potential target for CTL-based tumor therapy. J. Immunol. 158:3325-3334.
Macagno, A., M. Gilliet, F. Sallusto, A. Lanzavecchia, F. O. Nestle, and M. Groettrup. 1999. Dendritic cells up-regulate immunoproteasomes and the proteasome regulator PA28 during maturation. Eur. J. Immunol. 29:4037-4042.
Meidenbauer, N., A. Zippelius, M. J. Pittet, M. Laumer, S. Vogl, J. Heymann, M. Rehli, B. Seliger, S. Schwarz, F. A. Le Gal, P. Y. Dietrich, R. Andreesen, P. Romero, and A. Mackensen. 2004. High frequency of functionally active Melan-A-specific T cells in a patient with progressive immunoproteasome-deficient melanoma. Cancer Res. 64:6319-6326.
Morel, S., F. Levy, O. Burlet-Schiltz, F. Brasseur, M. Probst-Kepper, A. L. Peitrequin, B. Monsarrat, R. Van Velthoven, J. C. Cerottini, T. Boon, J. E. Gairin, and B. J. Van den Eynde. 2000. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity 12:107-117.
Nussbaum, A. K., T. P. Dick, W. Keilholz, M. Schirle, S. Stevanovic, K. Dietz, W. Heinemeyer, M. Groll, D. H. Wolf, R. Huber, H. G. Rammensee, and H. Schild. 1998. Cleavage motifs of the yeast 20S proteasome subunits deduced from digests of enolase 1. Proc. Natl. Acad. Sci. USA 95:12504-12509.
Nussbaum, A. K., C. Kuttler, K. P. Hadeler, H. G. Rammensee, and H. Schild. 2001. PAProC: a prediction algorithm for proteasomal cleavages available on the WWW. Immunogenetics 53:87-94.
Nussbaum, A. K., C. Kuttler, S. Tenzer, and H. Schild. 2003. Using the World Wide Web for predicting CTL epitopes. Curr. Opin. Immunol. 15:69-74.
Pamer, E., and P. Cresswell. 1998. Mechanisms of MHC class I-restricted antigen processing. Annu. Rev. Immunol. 16:323-358.
Reits, E. A., J. C. Vos, M. Gromme, and J. Neefjes. 2000. The major substrates for TAP in vivo are derived from newly synthesized proteins. Nature 404:774-778.
Rickinson, A. B., and E. Kieff. 2001. Epstein-Barr virus, p. 2575-2628. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
Rickinson, A. B., and D. J. Moss. 1997. Human cytotoxic T lymphocyte responses to Epstein-Barr virus infection. Annu. Rev. Immunol. 15:405-431.
Rivett, A. J., and A. R. Hearn. 2004. Proteasome function in antigen presentation: immunoproteasome complexes, peptide production, and interactions with viral proteins. Curr. Protein Pept. Sci. 5:153-161.
Rock, K. L., and A. L. Goldberg. 1999. Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17:739-779.
Rock, K. L., I. A. York, and A. L. Goldberg. 2004. Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat. Immunol. 5:670-677.
Schubert, U., L. C. Anton, J. Gibbs, C. C. Norbury, J. W. Yewdell, and J. R. Bennink. 2000. Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature 404:770-774.
Schultz, E. S., J. Chapiro, C. Lurquin, S. Claverol, O. Burlet-Schiltz, G. Warnier, V. Russo, S. Morel, F. Levy, T. Boon, B. J. Van den Eynde, and P. van der Bruggen. 2002. The production of a new MAGE-3 peptide presented to cytolytic T lymphocytes by HLA-B40 requires the immunoproteasome. J. Exp. Med. 195:391-399.
Seifert, U., H. Liermann, V. Racanelli, A. Halenius, M. Wiese, H. Wedemeyer, T. Ruppert, K. Rispeter, P. Henklein, A. Sijts, H. Hengel, P. M. Kloetzel, and B. Rehermann. 2004. Hepatitis C virus mutation affects proteasomal epitope processing. J. Clin. Investig. 114:250-259.
Sewell, A. K., D. A. Price, H. Teisserenc, B. L. Booth, Jr., U. Gileadi, F. M. Flavin, J. Trowsdale, R. E. Phillips, and V. Cerundolo. 1999. IFN- exposes a cryptic cytotoxic T lymphocyte epitope in HIV-1 reverse transcriptase. J. Immunol. 162:7075-7079.
Sijts, A., Y. Sun, K. Janek, S. Kral, A. Paschen, D. Schadendorf, and P. M. Kloetzel. 2002. The role of the proteasome activator PA28 in MHC class I antigen processing. Mol. Immunol. 39:165-169.
Sijts, A. J., T. Ruppert, B. Rehermann, M. Schmidt, U. Koszinowski, and P. M. Kloetzel. 2000. Efficient generation of a hepatitis B virus cytotoxic T lymphocyte epitope requires the structural features of immunoproteasomes. J. Exp. Med. 191:503-514.
Sun, Y., A. J. Sijts, M. Song, K. Janek, A. K. Nussbaum, S. Kral, M. Schirle, S. Stevanovic, A. Paschen, H. Schild, P. M. Kloetzel, and D. Schadendorf. 2002. Expression of the proteasome activator PA28 rescues the presentation of a cytotoxic T lymphocyte epitope on melanoma cells. Cancer Res. 62:2875-2882.
Tajima, K., Y. Ito, A. Demachi, K. Nishida, Y. Akatsuka, K. Tsujimura, T. Hida, Y. Morishima, H. Kuwano, T. Mitsudomi, T. Takahashi, and K. Kuzushima. 2004. Interferon- differentially regulates susceptibility of lung cancer cells to telomerase-specific cytotoxic T lymphocytes. Int. J. Cancer. 110:403-412.
Tellam, J., G. Connolly, K. J. Green, J. J. Miles, D. J. Moss, S. R. Burrows, and R. Khanna. 2004. Endogenous presentation of CD8+ T cell epitopes from Epstein-Barr virus-encoded nuclear antigen 1. J. Exp. Med. 199:1421-1431.
Toes, R. E., A. K. Nussbaum, S. Degermann, M. Schirle, N. P. Emmerich, M. Kraft, C. Laplace, A. Zwinderman, T. P. Dick, J. Muller, B. Schonfisch, C. Schmid, H. J. Fehling, S. Stevanovic, H. G. Rammensee, and H. Schild. 2001. Discrete cleavage motifs of constitutive and immunoproteasomes revealed by quantitative analysis of cleavage products. J. Exp. Med. 194:1-12.
Van Kaer, L., P. G. Ashton-Rickardt, M. Eichelberger, M. Gaczynska, K. Nagashima, K. L. Rock, A. L. Goldberg, P. C. Doherty, and S. Tonegawa. 1994. Altered peptidase and viral-specific T cell response in LMP2 mutant mice. Immunity 1:533-541.
Voo, K. S., T. Fu, H. Y. Wang, J. Tellam, H. E. Heslop, M. K. Brenner, C. M. Rooney, and R. F. Wang. 2004. Evidence for the presentation of major histocompatibility complex class I-restricted Epstein-Barr virus nuclear antigen 1 peptides to CD8+ T lymphocytes. J. Exp. Med. 199:459-470.
Wharton, S. A., and A. R. Hipkiss. 1984. Abnormal proteins of shortened length are preferentially degraded in the cytosol of cultured MRC5 fibroblasts. FEBS Lett. 168:134-138.
Wheatley, D. N., S. Grisolia, and J. Hernandez-Yago. 1982. Significance of the rapid degradation of newly synthesized proteins in mammalian cells: a working hypothesis. J. Theor. Biol 98:283-300.
Yewdell, J. W., E. Reits, and J. Neefjes. 2003. Making sense of mass destruction: quantitating MHC class I antigen presentation. Nat. Rev. Immunol. 3:952-961.(Yoshinori Ito, Eisei Kond)
Department of Internal Medicine II, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan
Department of Cell Therapy, Aichi Cancer Center Hospital, Nagoya, Japan
ABSTRACT
The precise roles of gamma interferon-inducible immunoproteasome-associated molecules in generation of cytotoxic T-lymphocyte (CTL) epitopes have yet to be fully elucidated. We describe here a unique epitope derived from the Epstein-Barr virus (EBV) latent membrane protein 2A (LMP2A) presented by HLA-A2402 molecules. Generation of the epitope, designated LMP2A222-230, from the full-length protein requires the immunoproteasome subunit low-molecular-weight protein 7 (ip-LMP7) and the proteasome activator 28- subunit and is accelerated by ip-LMP2, as revealed by gene expression experiments using an LMP2A222-230-specific CTL clone as a responder in enzyme-linked immunospot assays. The unequivocal involvement of all three components was confirmed by RNA interference gene silencing. Interestingly, the LMP2A222-230 epitope could be efficiently generated from incomplete EBV-LMP2A fragments that were produced by puromycin treatment or gene-engineered shortened EBV-LMP2A lacking some of its hydrophobic domains. In addition, epitope generation was increased by a single amino acid substitution from leucine to alanine immediately flanking the C terminus, this being predicted by a web-accessible program to increase the cleavage strength. Taken together, the data indicate that the generation of LMP2A222-230 is influenced not only by extrinsic factors such as immunoproteasomes but also by intrinsic factors such as the length of the EBV-LMP2A protein and proteasomal cleavage strength at specific positions in the source antigen.
INTRODUCTION
Cytotoxic T lymphocytes (CTLs) recognize short peptide products processed from target proteins and presented by major histocompatibility complex (MHC) class I molecules. The first step in protein processing in the cytosol is cleavage by proteasomes, proteolytic complexes playing a critical role in the antigen processing pathway. Resultant peptides are translocated by the transporters associated with antigen processing into the endoplasmic reticulum, where they assemble with newly synthesized MHC class I molecules for transportation to the cell surface (12, 28, 33). Proteasome catalytic activity is exerted by the 20S core proteasome, a cylindrical structure composed of four stacked rings. The outer two rings consist of seven different subunits, and the inner rings consist of seven different -type subunits. Enzymatic activity is mediated by three of the subunits, designated 1 (Y/), 2 (Z/MC14), and 5 (X/MB1) (33). Exposure of cells to gamma interferon (IFN-) during immune responses alters the proteasome activity qualitatively and quantitatively with the induction of three newly synthesized immunoproteasome subunits, low-molecular-weight protein 2 (ip-LMP2) or 1i, multicatalytic endopeptidase complex-like 1 (MECL-1) or 2i, and ip-LMP7 or 5i. These become incorporated interdependently and replace the three constitutive subunits in newly assembled immunoproteasomes (14, 22, 24). The expression of ip-LMP7 and/or ip-LMP2 is known to alter the proteasomal cleavage specificity for virus- and tumor-associated antigens (15, 39). Furthermore, the incorporation of ip-LMP7 is sufficient to alter cleavage properties of proteasomes although the role of its catalytic site remains unclear (8, 36, 38, 40). The expression of ip-LMP2 alone or with ip-LMP7 is also reported to change cleavage specificity (1, 19, 23), and effects of the two subunits have been observed in each subunit's knockout mice (4, 7, 45).
Besides its effects on immunoproteasomes, IFN- up-regulates expression of the proteasome activator 28 (PA28), which consists of two different subunits, and , that form a heptameric ring that binds to proteasomes and is thought to increase their rate of cleavage (39). Regarding contributions to epitope liberation, effects of the subunit have been observed (10, 41) but findings are limited regarding the subunit (41). Elucidating differential effects of the three immunoproteasome subunits and two PA28 subunits is clearly important for a better understanding of generation of CTL epitopes.
Recently, defective ribosomal products (DRiPs) from newly synthesized proteins, which are rapidly ubiquitylated and degraded by proteasomes, were shown to be the main sources of antigenic peptides (29, 35, 48, 49); this suggests that antigen structures are critical for efficient processing by proteasomes. While almost every amino acid residue can serve as a cleavage site, there are certain preferences (25, 27, 44). Because the C terminus of the CTL epitope is precisely determined by the proteasome, cleavage strength at specific positions, such as that immediately flanking the C terminus of the epitope, really affects epitope generation (14, 34). In fact, mutation in the flanking region of epitopes has been shown to impair the processing by proteasomes (2, 37). Thus, structural features play an important role in epitope liberation and could influence the working of the five immunoproteasome-associated subunits.
We have previously shown the generation of an HLA-A2402-restriced CTL epitope in the Epstein-Barr virus (EBV) latent membrane protein 2A (EBV-LMP2A), amino acids 222 to 230 (referred to as LMP2A222-230), to be dependent on IFN- exposure (18). Differential expression of ip-LMP2, MECL-1, ip-LMP7, PA28, and PA28 in various combinations has allowed us to selectively address the role of each subunit in the processing of the epitope independently of other IFN--inducible proteins, and we have established that the generation of LMP2A222-230 is cooperatively controlled by interplay among ip-LMP2, ip-LMP7, and PA28. Moreover, these observations were supported by the results of RNA interference experiments. We have now extended our studies to demonstrate that LMP2A structural factors influence epitope liberation in various target cells.
MATERIALS AND METHODS
CTL clones and epitopes. EBV-specific CTL lines and clones were established as described earlier (18). Briefly, EBV-specific T-cell lines were generated from peripheral blood mononuclear cells after stimulation with HLA-A2402-transfected, TAP-negative T2-A24 cells (18) pulsed with each epitope peptide or autologous EBV-carrying lymphoblastoid cell lines (LCLs). After several rounds of stimulation, CTL clones were established by a limiting dilution method. A polyclonal CTL line that was specific to the epitope LMP2A419-427 (TYGPVFMCL) (21) was designated LMP2A419-427-CTL, and CTL clones that were specific to the epitope LMP2A222-230 (IYVLVMLVL) (18) were designated LMP2A222-230-CTL.
Cell lines. T2-A24 cells were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin, and 800 μg/ml of G418 (Invitrogen Corp., Carlsbad, CA). HLA-A2402-positive LCLs and PT67 cells (BD Bioscience Clontech, Palo Alto, CA), retroviral packaging cell lines, were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin, and 50 μg/ml of kanamycin (referred to as LCL medium). HLA-A2402-positive LCLs expressing short hairpin RNA (shRNA) were maintained in LCL medium in the presence of 0.8 μg/ml of puromycin. HEK293 T cells (referred to as 293T; American Type Culture Collection, Manassas, VA) and HLA-A2402-positive dermal fibroblast cell lines were cultured in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin.
Expression vectors. Plasmids expressing various lengths of EBV-LMP2A and EBNA3A, from full-length proteins to minimal epitopes, were constructed as described previously (16, 18). Full-length HLA-A2402, ip-LMP2, ip-LMP7, MECL-1, PA28, and PA28 were amplified by reverse transcriptase (RT)-PCR from HLA-A2402-positive LCLs, cloned into the pcDNA3.1(+) vector (Invitrogen Corp.), and sequenced. A plasmid containing a mutant EBV-LMP2A gene with alanine substituted for leucine at position 231 was constructed by PCR-based mutagenesis as described previously (16). This single amino acid substitution was intended to increase the proteasome cleavage strength, as predicted with the Prediction Algorithm for Proteasomal Cleavages I program (PAProC version 1.0; http://www.paproc.de/) (17, 26).
Transduction of 293T cells. The plasmids encoding HLA-A2402 and EBV-LMP2A and at least one of those expressing ip-LMP2, ip-LMP7, MECL-1, PA28, or PA28 were transfected into 293T cells using TransIT-293 transfection reagents (Mirus, Madison, WI). Briefly, 3 x 104 cells were transfected with 100 ng of each plasmid and 0.2 μl TransIT reagent per 100 ng DNA in various combinations in 96-well plates. After 24 h, these cells were used as stimulators in the enzyme-linked immunospot (ELISPOT) assay.
shRNA interference retrovirus vectors. The following small interfering RNA targets were selected in this study: ip-LMP2, AAGUGAAGGAGGUCAGGUAUA; ip-LMP7, AGAUUAACCCUUACCUGCUTT; and PA28, AAGCCAACUUGAGCAAUCUGA. shRNA constructs included a TTCAAGAGA-loop separating the sense and antisense sequences followed by a 5T termination signal. These constructs were synthesized as two cDNA oligonucleotides, annealed, and ligated between the BamHI and EcoRI sites of the RNAi-Ready pSIREN-RetroQ vector (BD Biosciences Clontech). In addition, oligonucleotides with sequences selected by the company (BD Biosciences Clontech) as a negative control for gene silencing were annealed and inserted into the same vector.
Retrovirus production and infection. PT67 cells were plated on six-well culture plates, and a 4-μg aliquot of each retrovirus vector plasmid was transfected with Lipofectamine 2000 (Invitrogen Corp), according to the manufacturer's instructions. After culture in the presence of 2.5 μg/ml of puromycin for 14 days, the cells were incubated in medium without puromycin for another 48 h. The culture supernatant was collected, and debris was removed by centrifugation at 1,000 x g for 10 min. A total of 1 x 106 LCLs were suspended in 1 ml of the virus-containing culture supernatant in each well of a 12-well plate, and polybrene was added to a final concentration of 10 μg/ml. Plates were centrifuged at 1,000 x g at 32°C for 1 h and incubated at 37°C in a humidified incubator. The LCLs were then cultured in medium containing puromycin for 14 days. Expression of ip-LMP2, ip-LMP7, or PA28 in these LCLs was analyzed by Western blotting and RT-PCR for gene silencing.
Western blotting. Western blotting was performed as described previously with slight modifications (42). Briefly, aliquots of 130 μg protein were applied to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis, blotted onto Immobilon-P membranes (Millipore Corporation, Bedford, MA), blocked with phosphate-buffered saline containing 10% low-fat dry milk and 0.1% Tween 20 overnight at 4°C, and probed with rabbit polyclonal antibodies specific to ip-LMP2, ip-LMP7, and PA28 (Affinity, Mamhead, United Kingdom), followed by peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed, San Francisco, CA). Proteins were visualized using an ECL Western blot detection system (Amersham Biosciences, Buckinghamshire, United Kingdom).
RT-PCR. Total RNA was extracted from LCLs and reverse transcription was performed in 20-μl reactions containing random hexamers and 1-μg aliquots. The specific primer sets used to detect ip-LMP2, ip-LMP7, and PA28 were as follows: ip-LMP2 forward, 5'-GGTGGTGAACCGAGTGTTTGA-3'; ip-LMP2 reverse, 5'-GCCAAAACAAGTGGAGGTTCC-3'; ip-LMP7 forward, 5'-GATTGCAGCAGTGGATTCTCG-3'; ip-LMP7 reverse, 5'-GACATGGTGCCAAGCAGGTAA-3'; PA28 forward, 5'-ACCAAGACAGAGAACCTGCTCG-3'; and PA28 reverse, 5'-GGCCTTCAGATTGCTCAAGTTG-3'.
ELISPOT assays. ELISPOT assays were performed as previously described (18). In brief, a MultiScreen-HA plate (Millipore) was coated with anti-human IFN- monoclonal antibody (Endogen, Rockford, IL) and used as the assay plate. The following stimulator cells in 100 μl of LCL medium were seeded into the wells: (i) 293T cells cotransfected with plasmids expressing HLA-A2402 and those expressing various lengths of EBV-LMP2A (in some experiments, cells were treated with puromycin at 1 μg/ml for 30 min); (ii) 293T cells cotransfected with plasmids encoding HLA-A2402 and EBV-LMP2A and at least one of those two expressing ip-LMP2, ip-LMP7, MECL-1, PA28, or PA28b; and (iii) LCLs transduced by retrovirus vectors expressing shRNA for either ip-LMP2, ip-LMP7, or PA28a.
LMP2A222-230-CTLs or LMP2A419-427-CTLs in 100 μl medium were introduced into each well and incubated for 20 h. To visualize spots, anti-human IFN- polyclonal antibody (Endogen), horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed) and substrate were used. All assays were performed in duplicate.
RESULTS
LMP2A222-230 is not presented on target cells expressing full-length EBV-LMP2A. The LMP2A419-427-CTL responded to 293T cells pulsed with the epitope peptide and to those expressing full-length EBV-LMP2A cotransfected with HLA-A2402. However, the LMP2A222-230-CTL responded to 293T cells expressing the minimal epitope, but not full-length EBV-LMP2A, cotransfected with HLA-A2402 (Fig. 1).
As we reported previously, IFN--treated fibroblasts transduced with full-length EBV-LMP2A were recognized by LMP2A222-230-CTL, showing LMP2A222-230 to be an IFN--dependent epitope. This suggested that IFN--induced immunoproteasome and PA28 subunits generate LMP2A222-230 in the target cells (18).
Generation of LMP2A222-230 requires the immunoproteasome subunit ip-LMP7 and PA28 and is enhanced by ip-LMP2. To investigate whether immunoproteasome-associated molecules are involved in generating the LMP2A222-230 epitope, we examined the effect of each proteasome immunosubunit (ip-LMP2, ip-LMP7, and MECL-1) and PA28 subunit (PA28 and PA28) in 293T cells that dominantly have a standard proteasome. First, 293T cells were cotransfected with plasmids encoding HLA-A2402, the full-length EBV-LMP2A, and immunoproteasome-associated molecules in various combinations, as shown in Fig. 2A. We then evaluated epitope liberation using the ELISPOT assay. Surprisingly, three molecules were found to be involved in the generation of LMP2A222-230: ip-LMP7 and PA28 subunits were required, and the ip-LMP2 subunit enhanced its recognition (Fig. 2A). We confirmed the expression of ip-LMP2, ip-LMP7, and PA28 by Western blotting (Fig. 2B).
Inhibition of ip-LMP2, ip-LMP7, and PA28 expression in LCLs by RNA interference decreases the generation of LMP2A222-230 in target cells. LCLs predominantly have immunoproteasomes (24), and the LMP2A222-230-CTL have recognized HLA-A2402-positive LCLs, as we reported previously (18). To examine whether ip-LMP2, ip-LMP7, or PA28 is most directly involved in the generation of LMP2A222-230, we evaluated the epitope liberation in LCLs in which the expression of each subunit was separately inhibited using a gene-silencing technique. HLA-A2402-positive LCLs were infected with retrovirus vectors expressing shRNAs for ip-LMP2, ip-LMP7, or PA28 and assessed for the expression of each subunit by Western blotting (Fig. 3A, B, and C) and RT-PCR (data not shown). Then, generation of the LMP2A222-230 epitope was probed with epitope-specific CTL using the ELISPOT assay. As expected, epitope liberation was clearly decreased with the inhibition of ip-LMP2, ip-LMP7, or PA28 expression (Fig. 3A, B, and C), demonstrating definitive involvement of all three molecules in the generation of LMP2A222-230. To test whether the generation of IFN--independent EBV-LMP2 epitope was influenced in these LCLs transfected with shRNA expression vectors for ip-LMP2, ip-LMP7, or PA28, we investigated the generation of LMP2A419-427 using the ELISPOT assay. We found that there were no significant differences in the processing of this epitope. (data not shown).
Incomplete or shortened EBV-LMP2A results in efficient generation of LMP2A222-230 in target cells. Recently, DRiPs have been reported to be major sources of CTL epitopes (43, 46), suggesting that incomplete antigen proteins allow efficient processing. To test this possibility with regard to LMP2A222-230, 293T cells transduced with HLA-A2402 and full-length EBV-LMP2A together with ip-LMP7 and/or PA28 were treated with puromycin for 30 min to generate short-lived premature proteins (6, 13, 47). We then analyzed the generation of LMP2A222-230 by ELISPOT assay. As shown in Fig. 4A, puromycin treatment remarkably augmented LMP2A222-230-CTL recognition on the cells expressing ip-LMP7 and PA28. Interestingly, puromycin was capable of substituting either effect of ip-LMP7 and PA28.
Next, we introduced truncated EBV-LMP2A of different lengths starting from isoleucine at position 222, the first amino acid of LMP2A222-230, into expression vectors (Fig. 4B). The generation of LMP2A222-230 was studied in 293T cells cotransfected with vectors encoding HLA-A2402 and each truncated EBV-LMP2A without immunoproteasomes and PA28 subunits. Interestingly, the shortest EBV-LMP2A antigen was processed most efficiently and all truncated EBV-LMP2A antigens could be processed to generate LMP2A222-230 without the aid of immunoproteasomes and PA28 (Fig. 4C). These data clearly demonstrated that the efficiency of LMP2A222-230 generation is, at least in part, dependent on the length of the source protein.
Substitution of amino acid immediately flanking the C terminus of LMP2A222-230, increasing the proteasome cleavage strength, results in efficient generation of LMP2A222-230 in target cells. Finally, we investigated whether the amino acid cleavage strength at a specific position affects the processing of the LMP2A222-230 epitope. To determine the cleavage strength of each amino acid in EBV-LMP2A, the program PAProC was used (http://www.paproc.de/). We focused on the cleavage strength, which is critical for epitope generation, of amino acids in the position immediately flanking the C termini of CTL epitopes (14, 34). First, we constructed a plasmid containing a mutant full-length LMP2A gene in which alanine replaced leucine at position 231; this was predicted to increase the cleavage strength after leucine at position 230, i.e., the C terminus of LMP2A222-230 (Fig. 5A). It was thought that this change would facilitate LMP2A222-230 generation by proteasomes. Target 293T cells were cotransfected with vectors encoding HLA-A2402, ip-LMP7, PA28, and the mutant EBV-LMP2A, and LMP2A222-230-CTL recognition was evaluated using the ELISPOT assay. A remarkable increase was evident for cells expressing ip-LMP7 and PA28 (Fig. 5B), suggesting the processing of LMP2A222-230 to be accelerated by the amino acid substitution at the specific position in the EBV-LMP2A antigen.
DISCUSSION
IFN- induces cells to express the proteasome subunits ip-LMP2, MECL-1, and ip-LMP7, leading to the formation of immunoproteasomes and the proteasome activator subunits PA28 and PA28, comprising the activator complex. Early experiments with IFN--treated cells demonstrated the generation of a number of epitopes to be affected by immunoproteasomes and PA28 (15, 32, 44). Immunoproteasomes have various cleavage site preferences as well as cleavage rates for the generation of some epitopes, while PA28 up-regulates epitope liberation via conformational changes within the proteasome 20S complex. Following the discovery that the influenza virus matrix-derived epitope required ip-LMP7 expression for its generation (3), the involvement of immunoproteasomes and PA28 subunits with different CTL epitopes received much attention. The results of the studies that investigated the effect of at least two immunoproteasome-associated molecules in the generation of CTL epitopes are summarized in Table 1 (1, 8, 10, 19, 23, 36, 38, 40, 41). The combination patterns of the five immunoproteasome-associated subunits fall into three categories. (i) PA28 alone, (ii) ip-LMP7 alone, and (iii) both ip-LMP2 and ip-LMP7 exerted the epitope generation. It has been hypothesized that immunoproteasomes and PA28 cooperate in antigen processing, but direct experimental evidence has hitherto been lacking. In this study, we found that the LMP2A222-230 epitope has two unique features. First, coexpression of ip-LMP7 and one PA28 subunit is necessary for its generation. Second, ip-LMP2 has additional effects on epitope liberation. These data suggest that the processing of an IFN--inducible epitope is controlled differentially by multiple immunoproteasome-associated subunits. To our best knowledge, this is the first documentation of molecular evidence of such cooperation.
Incorporation of the immunoproteasome is reported to be cooperative. The ip-LMP7 is required for immunoproteasome formation and maturation (9, 14). MECL-1 is incorporated if ip-LMP2 is present, while MECL-1 dependency for the incorporation of ip-LMP2 is under dispute (5, 11). Moreover, this cooperativity in forming proteasome complexes results in altered cleavage properties. In the present study, the generation of LMP2A222-230 is enhanced by ip-LMP2 expression. This effect may be exerted through the functions of ip-LMP7 and PA28, which induce the cleavages properties on the epitope generation.
In this study, we developed a retrovirus vector producing shRNA to confirm the effects of ip-LMP2, ip-LMP7, and PA28 in the generation of LMP2A222-230. Generally, the use of chemically synthesized small interfering RNA or expression plasmids for shRNA is a more feasible way to test the involvement of target molecules but we believe that the retrovirus system has advantages in our case, because the effects of RNA interference in the target cells proved stable. After an epitope binds to MHC molecules and is presented on the cell surface, the complex exists for some time. Since there is a wide range in the life spans of the MHC-epitope complex, it is difficult to infer the sufficient duration to maintain inhibition of immunoproteasome-associated subunits to examine their effects in peptide liberation. In our retrovirus system, LCLs were cultured in medium containing puromycin for 14 days after retrovirus vector infection, and we assessed LMP2A222-230 presentation on the surface. This procedure should exclude false-positive results that are observed with the ELISPOT assay.
DRiPs are thought to be important sources of CTL epitopes (29, 35, 49), as in the case of EBNA1, for example, for which epitopes are not readily generated from stable mature EBNA1 because of the glycine-alanine repeat domain within the protein (43, 46). EBV-LMP2A has 12 hydrophobic integral membrane sequences, and this hydrophobic-rich structure may inhibit epitope liberation (20). To address the question of whether the incomplete EBV-LMP2A might be superior to the mature complete EBV-LMP2A for epitope generation, we treated target cells with puromycin, which generates short-lived premature termination products from newly synthesized proteins (6, 13, 47). Interestingly, LMP2A222-230 production was accelerated in puromycin-treated 293T cells expressing ip-LMP7 or PA28, in contrast to the limited yield without puromycin treatment, even when the subunits were coexpressed. The data suggest that puromycin treatment is not sufficient to generate LMP2A222-230 epitopes via constitutive proteasomes, but rather affects epitope generation by enhancing the effect of ip-LMP7 and PA28. Next, we expressed a panel of shorter EBV-LMP2A fragments encompassing LMP2A222-230 in target cells and compared their recognition to that of LMP2A222-230-CTL. Each fragment started from the N terminus of LMP2A222-230, as shown in Fig. 4B. This strategy should focus on the cleavage efficiency of the C- terminal side, which is performed exclusively by proteasomes (14, 34). We found that shorter EBV-LMP2A fragments were processed more efficiently. Therefore, the length of the source antigen may be a critical factor. Addition of two consecutive hydrophobic transmembrane domains substantially abrogated the epitope presentation. The obstacles presented by the intrinsic structure of EBV-LMP2A may be overcome by the effects of ip-LMP7 and PA28 in the generation of the LMP2A222-230 epitope.
The cleavage efficiency at each amino acid varies widely in antigen proteins (25, 27, 44), and this may explain why one epitope is generated efficiently by proteasomes while another is not, even when processed from the same protein. Previous work showed that even a single amino acid substitution of asparagine for the aspartic acid immediately flanking the C terminus of the Moloney murine leukemia virus epitope SSWDFITV resulted in its abrogation (2). The program PAProC predicts that the cleavage strength of the C- terminal leucine in EBV-LMP2A is weak (17, 26), and substitution of an amino acid to increase the cleavage strength (from "+" to "++", as shown in Fig. 5A) resulted in remarkable up-regulation of LMP2A222-230 liberation in cells expressing ip-LMP7 and PA28.
EBV-LMP2A is thought to be an important antigen in EBV-related malignancies and is targeted by CTLs that recognize multiple epitopes located throughout the membrane-spanning molecules (20, 30, 31). Interestingly, EBV-LMP2A epitopes can be divided into two groups: (i) hydrophobic examples located in the transmembrane domain and processed in a TAP-independent manner and (ii) intertransmembrane hydrophilic epitopes, which are TAP-dependent (20). In addition, the generation of one hydrophobic epitope, LMP2A356-364, requires ip-LMP7 and ip-LMP2 (19). Moreover, we here demonstrated that the processing of LMP2A222-230 requires immunoproteasome subunits ip-LMP7 and PA28 and is enhanced by immunoproteasome subunit ip-LMP2. These two epitopes belong to the former group, although the effects of immunoproteasome and PA28 subunits on other epitopes remain to be investigated. Potentially, EBV-LMP2A is a good model for determining the mechanisms by which immunoproteasomes and PA28 affect CTL epitope generation.
In conclusion, the present investigation provided evidence for differential roles of ip-LMP2, ip-LMP7, and PA28 in the generation of the LMP2A222-230 epitope, which was most efficiently generated from incomplete EBV-LMP2A fragments and a mutated LMP2A gene with improved cleavage characteristics in cells expressing ip-LMP7 and PA28. Although the precise function of each of the three subunits could not be clarified, we showed the generation of LMP2A222-230 to be controlled by multiple factors. Further investigations on the differential effects of immunoproteasome-associated subunits could provide important information for understanding the presentation of viral and tumor antigens for CTL recognition.
ACKNOWLEDGMENTS
We thank K. Nishida and F. Ando for technical expertise and H. Tamaki and Y. Matsudaira for secretarial assistance.
This work was supported in part by Grants-in-Aid for Scientific Research (C) (no. 17590428) and the Encouragement of Young Scientists (B) (no. 16790281) from the Japan Society for the Promotion of Science, Scientific Research on Priority Areas (no. 17016090) from the Ministry of Education, Culture, Science, Sports, and Technology of Japan and the Third Team Comprehensive Control Research for Cancer (no. 30) from the Ministry of Health, Labor, and Welfare of Japan.
REFERENCES
Basler, M., N. Youhnovski, M. van den Broek, M. Przybylski, and M. Groettrup. 2004. Immunoproteasomes down-regulate presentation of a subdominant T cell epitope from lymphocytic choriomeningitis virus. J. Immunol. 173:3925-3934.
Beekman, N. J., P. A. van Veelen, T. van Hall, A. Neisig, A. Sijts, M. Camps, P. M. Kloetzel, J. J. Neefjes, C. J. Melief, and F. Ossendorp. 2000. Abrogation of CTL epitope processing by single amino acid substitution flanking the C-terminal proteasome cleavage site. J. Immunol. 164:1898-1905.
Cerundolo, V., A. Kelly, T. Elliott, J. Trowsdale, and A. Townsend. 1995. Genes encoded in the major histocompatibility complex affecting the generation of peptides for TAP transport. Eur. J. Immunol. 25:554-562.
Chen, W., C. C. Norbury, Y. Cho, J. W. Yewdell, and J. R. Bennink. 2001. Immunoproteasomes shape immunodominance hierarchies of antiviral CD8+ T cells at the levels of T cell repertoire and presentation of viral antigens. J. Exp. Med. 193:1319-1326.
De, M., K. Jayarapu, L. Elenich, J. J. Monaco, R. A. Colbert, and T. A. Griffin. 2003. 2 subunit propeptides influence cooperative proteasome assembly. J. Biol. Chem. 278:6153-6159.
Eggers, D. K., W. J. Welch, and W. J. Hansen. 1997. Complexes between nascent polypeptides and their molecular chaperones in the cytosol of mammalian cells. Mol. Biol. Cell 8:1559-1573.
Fehling, H. J., W. Swat, C. Laplace, R. Kuhn, K. Rajewsky, U. Muller, and H. von Boehmer. 1994. MHC class I expression in mice lacking the proteasome subunit LMP-7. Science 265:1234-1237.
Gileadi, U., H. T. Moins-Teisserenc, I. Correa, B. L. Booth, Jr., P. R. Dunbar, A. K. Sewell, J. Trowsdale, R. E. Phillips, and V. Cerundolo. 1999. Generation of an immunodominant CTL epitope is affected by proteasome subunit composition and stability of the antigenic protein. J. Immunol. 163:6045-6052.
Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. V. Kaer, J. J. Monaco, and R. A. Colbert. 1998. Immunoproteasome assembly: cooperative incorporation of interferon (IFN-)-inducible subunits. J. Exp. Med. 187:97-104.
Groettrup, M., A. Soza, M. Eggers, L. Kuehn, T. P. Dick, H. Schild, H. G. Rammensee, U. H. Koszinowski, and P. M. Kloetzel. 1996. A role for the proteasome regulator PA28 in antigen presentation. Nature 381:166-168.
Groettrup, M., S. Standera, R. Stohwasser, and P. M. Kloetzel. 1997. The subunits MECL-1 and LMP2 are mutually required for incorporation into the 20S proteasome. Proc. Natl. Acad. Sci. USA 94:8970-8975.
Heemels, M. T., and H. Ploegh. 1995. Generation, translocation, and presentation of MHC class I-restricted peptides. Annu. Rev. Biochem. 64:463-491.
Hightower, L. E. 1980. Cultured animal cells exposed to amino acid analogues or puromycin rapidly synthesize several polypeptides. J. Cell. Physiol. 102:407-427.
Kloetzel, P. M. 2001. Antigen processing by the proteasome. Nat. Rev. Mol. Cell Biol. 2:179-187.
Kloetzel, P. M. 2004. Generation of major histocompatibility complex class I antigens: functional interplay between proteasomes and TPPII. Nat. Immunol. 5:661-669.
Kondo, E., Y. Akatsuka, K. Kuzushima, K. Tsujimura, S. Asakura, K. Tajima, Y. Kagami, Y. Kodera, M. Tanimoto, Y. Morishima, and T. Takahashi. 2004. Identification of novel CTL epitopes of CMV-pp65 presented by a variety of HLA alleles. Blood 103:630-638.
Kuttler, C., A. K. Nussbaum, T. P. Dick, H. G. Rammensee, H. Schild, and K. P. Hadeler. 2000. An algorithm for the prediction of proteasomal cleavages. J. Mol. Biol. 298:417-429.
Kuzushima, K., N. Hayashi, A. Kudoh, Y. Akatsuka, K. Tsujimura, Y. Morishima, and T. Tsurumi. 2003. Tetramer-assisted identification and characterization of epitopes recognized by HLA A2402-restricted Epstein-Barr virus-specific CD8+ T cells. Blood 101:1460-1468.
Lautscham, G., T. Haigh, S. Mayrhofer, G. Taylor, D. Croom-Carter, A. Leese, S. Gadola, V. Cerundolo, A. Rickinson, and N. Blake. 2003. Identification of a TAP-independent, immunoproteasome-dependent CD8+ T-cell epitope in Epstein-Barr virus latent membrane protein 2. J. Virol. 77:2757-2761.
Lautscham, G., S. Mayrhofer, G. Taylor, T. Haigh, A. Leese, A. Rickinson, and N. Blake. 2001. Processing of a multiple membrane spanning Epstein-Barr virus protein for CD8+ T cell recognition reveals a proteasome-dependent, transporter associated with antigen processing-independent pathway. J. Exp. Med. 194:1053-1068.
Lee, S. P., R. J. Tierney, W. A. Thomas, J. M. Brooks, and A. B. Rickinson. 1997. Conserved CTL epitopes within EBV latent membrane protein 2: a potential target for CTL-based tumor therapy. J. Immunol. 158:3325-3334.
Macagno, A., M. Gilliet, F. Sallusto, A. Lanzavecchia, F. O. Nestle, and M. Groettrup. 1999. Dendritic cells up-regulate immunoproteasomes and the proteasome regulator PA28 during maturation. Eur. J. Immunol. 29:4037-4042.
Meidenbauer, N., A. Zippelius, M. J. Pittet, M. Laumer, S. Vogl, J. Heymann, M. Rehli, B. Seliger, S. Schwarz, F. A. Le Gal, P. Y. Dietrich, R. Andreesen, P. Romero, and A. Mackensen. 2004. High frequency of functionally active Melan-A-specific T cells in a patient with progressive immunoproteasome-deficient melanoma. Cancer Res. 64:6319-6326.
Morel, S., F. Levy, O. Burlet-Schiltz, F. Brasseur, M. Probst-Kepper, A. L. Peitrequin, B. Monsarrat, R. Van Velthoven, J. C. Cerottini, T. Boon, J. E. Gairin, and B. J. Van den Eynde. 2000. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity 12:107-117.
Nussbaum, A. K., T. P. Dick, W. Keilholz, M. Schirle, S. Stevanovic, K. Dietz, W. Heinemeyer, M. Groll, D. H. Wolf, R. Huber, H. G. Rammensee, and H. Schild. 1998. Cleavage motifs of the yeast 20S proteasome subunits deduced from digests of enolase 1. Proc. Natl. Acad. Sci. USA 95:12504-12509.
Nussbaum, A. K., C. Kuttler, K. P. Hadeler, H. G. Rammensee, and H. Schild. 2001. PAProC: a prediction algorithm for proteasomal cleavages available on the WWW. Immunogenetics 53:87-94.
Nussbaum, A. K., C. Kuttler, S. Tenzer, and H. Schild. 2003. Using the World Wide Web for predicting CTL epitopes. Curr. Opin. Immunol. 15:69-74.
Pamer, E., and P. Cresswell. 1998. Mechanisms of MHC class I-restricted antigen processing. Annu. Rev. Immunol. 16:323-358.
Reits, E. A., J. C. Vos, M. Gromme, and J. Neefjes. 2000. The major substrates for TAP in vivo are derived from newly synthesized proteins. Nature 404:774-778.
Rickinson, A. B., and E. Kieff. 2001. Epstein-Barr virus, p. 2575-2628. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
Rickinson, A. B., and D. J. Moss. 1997. Human cytotoxic T lymphocyte responses to Epstein-Barr virus infection. Annu. Rev. Immunol. 15:405-431.
Rivett, A. J., and A. R. Hearn. 2004. Proteasome function in antigen presentation: immunoproteasome complexes, peptide production, and interactions with viral proteins. Curr. Protein Pept. Sci. 5:153-161.
Rock, K. L., and A. L. Goldberg. 1999. Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17:739-779.
Rock, K. L., I. A. York, and A. L. Goldberg. 2004. Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat. Immunol. 5:670-677.
Schubert, U., L. C. Anton, J. Gibbs, C. C. Norbury, J. W. Yewdell, and J. R. Bennink. 2000. Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature 404:770-774.
Schultz, E. S., J. Chapiro, C. Lurquin, S. Claverol, O. Burlet-Schiltz, G. Warnier, V. Russo, S. Morel, F. Levy, T. Boon, B. J. Van den Eynde, and P. van der Bruggen. 2002. The production of a new MAGE-3 peptide presented to cytolytic T lymphocytes by HLA-B40 requires the immunoproteasome. J. Exp. Med. 195:391-399.
Seifert, U., H. Liermann, V. Racanelli, A. Halenius, M. Wiese, H. Wedemeyer, T. Ruppert, K. Rispeter, P. Henklein, A. Sijts, H. Hengel, P. M. Kloetzel, and B. Rehermann. 2004. Hepatitis C virus mutation affects proteasomal epitope processing. J. Clin. Investig. 114:250-259.
Sewell, A. K., D. A. Price, H. Teisserenc, B. L. Booth, Jr., U. Gileadi, F. M. Flavin, J. Trowsdale, R. E. Phillips, and V. Cerundolo. 1999. IFN- exposes a cryptic cytotoxic T lymphocyte epitope in HIV-1 reverse transcriptase. J. Immunol. 162:7075-7079.
Sijts, A., Y. Sun, K. Janek, S. Kral, A. Paschen, D. Schadendorf, and P. M. Kloetzel. 2002. The role of the proteasome activator PA28 in MHC class I antigen processing. Mol. Immunol. 39:165-169.
Sijts, A. J., T. Ruppert, B. Rehermann, M. Schmidt, U. Koszinowski, and P. M. Kloetzel. 2000. Efficient generation of a hepatitis B virus cytotoxic T lymphocyte epitope requires the structural features of immunoproteasomes. J. Exp. Med. 191:503-514.
Sun, Y., A. J. Sijts, M. Song, K. Janek, A. K. Nussbaum, S. Kral, M. Schirle, S. Stevanovic, A. Paschen, H. Schild, P. M. Kloetzel, and D. Schadendorf. 2002. Expression of the proteasome activator PA28 rescues the presentation of a cytotoxic T lymphocyte epitope on melanoma cells. Cancer Res. 62:2875-2882.
Tajima, K., Y. Ito, A. Demachi, K. Nishida, Y. Akatsuka, K. Tsujimura, T. Hida, Y. Morishima, H. Kuwano, T. Mitsudomi, T. Takahashi, and K. Kuzushima. 2004. Interferon- differentially regulates susceptibility of lung cancer cells to telomerase-specific cytotoxic T lymphocytes. Int. J. Cancer. 110:403-412.
Tellam, J., G. Connolly, K. J. Green, J. J. Miles, D. J. Moss, S. R. Burrows, and R. Khanna. 2004. Endogenous presentation of CD8+ T cell epitopes from Epstein-Barr virus-encoded nuclear antigen 1. J. Exp. Med. 199:1421-1431.
Toes, R. E., A. K. Nussbaum, S. Degermann, M. Schirle, N. P. Emmerich, M. Kraft, C. Laplace, A. Zwinderman, T. P. Dick, J. Muller, B. Schonfisch, C. Schmid, H. J. Fehling, S. Stevanovic, H. G. Rammensee, and H. Schild. 2001. Discrete cleavage motifs of constitutive and immunoproteasomes revealed by quantitative analysis of cleavage products. J. Exp. Med. 194:1-12.
Van Kaer, L., P. G. Ashton-Rickardt, M. Eichelberger, M. Gaczynska, K. Nagashima, K. L. Rock, A. L. Goldberg, P. C. Doherty, and S. Tonegawa. 1994. Altered peptidase and viral-specific T cell response in LMP2 mutant mice. Immunity 1:533-541.
Voo, K. S., T. Fu, H. Y. Wang, J. Tellam, H. E. Heslop, M. K. Brenner, C. M. Rooney, and R. F. Wang. 2004. Evidence for the presentation of major histocompatibility complex class I-restricted Epstein-Barr virus nuclear antigen 1 peptides to CD8+ T lymphocytes. J. Exp. Med. 199:459-470.
Wharton, S. A., and A. R. Hipkiss. 1984. Abnormal proteins of shortened length are preferentially degraded in the cytosol of cultured MRC5 fibroblasts. FEBS Lett. 168:134-138.
Wheatley, D. N., S. Grisolia, and J. Hernandez-Yago. 1982. Significance of the rapid degradation of newly synthesized proteins in mammalian cells: a working hypothesis. J. Theor. Biol 98:283-300.
Yewdell, J. W., E. Reits, and J. Neefjes. 2003. Making sense of mass destruction: quantitating MHC class I antigen presentation. Nat. Rev. Immunol. 3:952-961.(Yoshinori Ito, Eisei Kond)