Erythropoietin but not methylprednisolone effect on expression of anti-apoptotic survivin and aven genes in rat lung tissue after traumatic
http://www.100md.com
《中华医药杂志》英文版 2006年第3期
Correspondence to Kanat Ozisik, MD,Birlik mah. 9. Cad.Vadi Apt. No.107/12,Ankara 06550，Turkey
Tel: +90-505- 2901885,Fax: +90-312-3170353,E-mail: sozisik2002@yahoo.comwere to investigate the two anti-apoptotic signals survivin and aven in rat lung tissue after TBI to assess the protection of the lung from secondary injury conferred by MPSS and EPO comparatively.
[Abstract]ObjectiveWe have recently shown that experimental traumatic brain injury (TBI) results in ultrastructural damage in lung tissue. The aim of this study was to determine the two anti-apoptotic signals survivin and aven in rat lung tissue following TBI and compare the effect of erythropoietin (EPO) and methylprednisolone (MPSS). MethodsThirty-six Wistar-Albino female rats weighing 190~230 g were used, which were allocated into 6 groups. Group 1 received head trauma and no treatment. Group 2 and Group 3 received head trauma and intraperitoneally 1000 IU/kg EPO and MPSS (30 mg/kg), respectively. Group 4 (vehicle), received head trauma and intraperitoneally albumin (0.4 ml/rat). Group 5 and 6 were the control and sham operated groups, respectively. A weight-drop method was used to achieve head trauma. Real-time quantitative polymerase chain reaction was used for both survivin and aven gene expression at the total RNA level.ResultsBoth survivin and aven were higher in the EPO treatment group than in the trauma group (P<0.05,P<0.05, respectively). When we compared survivin and aven between EPO and MPSS groups, there was no important association (P>0.05,P>0.05, respectively). Also both survivin and aven were significantly higher in the EPO treatment group than vehicle, control and sham-operated groups. ConclusionsThese findings suggest that EPO may play an important role in the expression of antiapoptotic survivin and aven genes in the lung tissue after TBI.
[Key words] survivin;aven;erythropoietin;methylprednisolone;lung;head injuries
INTRODUCTION
Brain trauma is a major cause of morbidity and mortality, both in adult and paediatric populations. Much of the functional deficit derives from delayed cell death resulting from induction of neurotoxic factors that overwhelm endogenous neuroprotective responses[1]. Brain injured patients have an increased risk of extracerebral organ failure, mainly pulmonary dysfunction[2]. In our previous study, we have shown that experimental TBI causes obvious gradual injury on ultrastructure of the type Ⅱ pneumocytes[3]. Pathophysiology of lung tissue injury after severe TBI must be well understood, including the apoptotic processes.
A member of the inhibitor of apoptosis (IAP) gene family[4], survivin also known as Birc5, has been demonstrated to have a unique, dual role in the regulation of cell proliferation and cell death. Elevated levels of survivin are found in human fetal lung, liver, heart, kidney and gastrointestinal tract. Survivin prevents apoptosis by blocking caspase activity and it is expressed as the G2/M phase of the cycle[5,6].
A new intracellular membrane protein, aven,has now been shown to bind both bcl-xL and Apaf-1. Aven is broadly expressed and is conserved in mammalian species. It suppresses apoptosis induced Apaf-1 and caspase-9. Thus, aven represents a new class of cell death regulator[7].
The ability of potentially therapeutic agents to induce the expression of survivin and aven proteins might provide a new avenue for therapy to prevent lung tissue damage after TBI. Therefore, our aims in this study
MATERIALS AND METHODS
All animals received humane care in compliance with “the Guide for the Care and Use of Laboratory Animals” (National Institutes of Health, USA, Publication No. 85-23, revised 1996). The Animal Care Committee of the Ankara Hospital approved the protocols used in this study. The rats were randomly allocated into 6 groups and all groups contained 6 rats.
Trauma group: TBI of 300 g-cm was produced.
Erythropoietin group: r-Hu-EPO (1000 IU/kg; Eprex, Cilag AG, Zug, Switzerland) was administered intraperitoneally immediately after TBI.
Methylprednisolone group: MPSS in a dose of 30 mg/kg was administered intraperitoneally immediately after TBI.
Vehicle group: Albumin; intraperitoneally-bolus (0.4 ml/rat) directly after trauma.Control group: Tissue samples immediately after thoracotomy; no head surgery.
Sham operated group: Scalp was closed after craniotomy; no trauma. Tissue samples were obtained 24 hours after induced trauma in all groups, except the control group.
Surgical Procedure
The surgical procedure was performed under general anaesthesia induced by intramuscular xylasine (Bayer, Istanbul, Turkey) (10 mg/kg) and ketamine hydrochloride (Parke Davis, Istanbul, Turkey) (60 mg/kg) injections. Rats each were placed in prone position. Right frontoparietal craniectomies were carried out lateral to the sagittal sinus by dental drill system. The dura was exposed and left intact. Trauma was induced according to the study recently done by our research team[3]. Body temperature was continuously monitored with a rectal thermometer and maintained at 37 ℃ using a heating pad and an overhead lamp. Rats were not intubated. They were given free access to food and water. None of the animals died during the study period. But severe injured animals which had no treatment were very sick and hypoactive at the end of the 24 hours.
Obtaining Samples from Lung Parenchyma
Twenty-four hours after TBI for all groups except the control group, rats were re-anaesthetized. Midline sternotomy and bilateral thoracotomy were performed. The systemic circulation was perfused with 0.9% NaCl. Then, rats were killed with decipitation under general anaesthesia. Samples were all obtained from the left pulmonary lobes. Samples were collected in randomly numbered containers and given to the blinded observers. After evaluating the numbered tissues, results were collected in the appropriate group lists.
Isolation of RNA and Synthesis of cDNA
Samples were immediately frozen in liquid nitrogen at -80°C. Total RNA of each lung tissues isolated using a high pure RNA tissue kit (Roche Diagnostics, Germany) were assessed for RNA integrity electrophoretically verified with ethidium bromide staining and by OD260/OD280 nm absorption ratio >1.95. One μg of total RNA was used for cDNA synthesis using first strand cDNA synthesis kit for RT-PCR (AMV) (Roche Diagnostics, Germany) according to the manufacturer’s protocol.
Quantitative Real-Time PCR Analysis
Real-time quantitative PCR was performed to assess transcripts of aven and survivin relative to the housekeeping gene b-actin. The cDNA was used for quantitative real-time PCR amplification with SYBR Green I chemistry (Roche Applied Sciences, Germany). Primers were designed using Primer Premier 5 software (Premier Biosoft International, USA). Aven primers were F 5′ GACTTCAGTGTCCTCTTGAG 3′ and R 5′ CCTTGCCATCATCGTTTCTC 3′ (GenBank Acc. no. XM230438), survivin primers were F 5′ GCCACTTGTCCCAGCTTTCC 3′ and R 5′ GTCACAATAGAGCAAAGCCACA 3′ (GenBank Acc. no. AF276775) and b-actin primers were 5’ TCTTTAATGTCACGCACGATT 3’ and 5’ TCACCCACACTGTGCCCAT ’ (GenBank Acc. no. XM230438). The real-time PCR reactions were carried out in a total volume of 10 μl with 0.5 mM of each primers and MgCl2 4 mM using FastStart DNA Master SYBR Green I kit (Roche Applied Sciences, Germany). The b-actin mRNA was quantified to adjust the amount of mRNA in each sample with b-actin primer set.
The cycling parameters were 10 min at 95°C for activating hot start Taq polymerase, 45 cycles of 10 seconds at 95°C, 5 seconds at 60°C for amplification and quantification, 10 seconds at 72°C and 0 seconds at 80°C for extension. Fluorescence readings were performed at 84°C every cycle to prevent fluorescence from primer dimers. The specificity of all individual amplification reactions was confirmed by melting curve analysis. The assays used b-actin as the endogenous internal housekeeping gene that revealed less variability and better reproducibility in our method. Real-time expression values were calculated using the relative standard curve method. Standard curves were generated for each mRNA using 10-fold serial dilutions for both the target of interest and the endogenous control (b-actin) by measuring the cycle number at which exponential amplification occurred in a dilution series of samples. Values were normalized to the relative amounts of b-actin mRNA, which were obtained from a similar standard curve. In real-time PCR reactions the same initial amounts of target molecules were used, and the Cp values of b-actin mRNA were constant in all samples.
Statistical Analysis
Data are reported as mean values ± standard deviation (SD). Two-tailed Student’s t tests were used for two group comparisons. Differences with P values less than 0.05 were regarded as statistically significant.
RESULTS
Survivin expression ratios measured in the cardiac myocytes samples in all groups (Figure 1). Intraperitoneal administration of EPO produced a significant increase in the survivin expression (P<0.05) compared with trauma group suggested that EPO has anti-apoptotic effect in lung tissue after TBI. These results showed no statistically significant difference in survivin expression ratios between EPO and MPSS treatment groups. Treatment with vehicle solution did not produce a significant increase in the survivin expression in lung tissue after TBI (P>0.05).
Intraperitoneal administration of EPO produced a significant increase in the aven expression (P<0.05) compared with trauma group suggested that EPO has anti-apoptotic effect in lung tissue after TBI (Figure 2). These results showed no statistically significant difference in aven expression ratios between EPO and MPSS treatment groups. The difference between trauma and vehicle-treated group was not statistically significant (P>0.05).
Also, these results provided that there was no statistically significant differences of survivin and aven levels between control and sham groups, respectively.
Figure 1 Figure shows survivin expression ratios measured in the lung tissue samples in all groups. EPO produced a significant increase in the survivin expression (P<0.05) compared with trauma group indicating preservation of lung. When we compared survivin expression ratios between EPO and MPSS treatment groups, there was no important association (P<0.05). Note that vehicle solution did not produce a significant increase in the survivin expression in lung tissue after TBI (P>0.05)
Figure 2Figure shows aven expression ratios measured in the lung tissue samples in all groups. EPO produced a significant increase in the aven expression compared with trauma group indicating preservation of lung. When we compared aven expression ratios between EPO and MPSS treatment groups, there was no important association (P>0.05). Note that the difference between trauma and vehicle-treated group was not statistically significant (P>0.05)
DISCUSSION
Increasing evidence suggests that pulmonary dysfunction resulting from acute oxygen toxicity is at least in part due to the injury and death of lung cells. Studies using morphological and biochemical analyses revealed that hyperoxia-induced pulmonary cell death is multimodal, involving not only necrosis, but also apoptosis. A correlative relationship between the severity of hyperoxic acute lung injury and increased apoptosis has been supported by numerous studies in a variety of animal models. Cell death and lung injury are associated with increased expression of several apoptotic regulatory proteins such as p53 and bcl-2, and DNA damage-induced proteins[8].
It seems there is not a single mechanism to be accepted occurring after TBI as stated in detail belove.
EPO is a hematopoietic growth factor that stimulates proliferation and differentiation of erythroid precursor cells[9]. Recent studies have made known the significance of the non-erythropoietic effects of EPO. EPO is an endogenous cytokine with anti-apoptotic, anti-inflammatory, and neurotrophic properties[10].It has been revealed that EPO protects the ultrastructure of pneumocyte type Ⅱ cells and tracheobronchial epithelia against damage after TBI [11,12].
MPSS has been shown to have a biphasic effect on alveolar capillary integrity after elevated cerebrospinal fluid pressure, whereby low dose MPSS minimized the extent of lung haemorrhage, pulmonary capillary leakage, and loss of lung compliance. In contrast, MPSS high dose accelerated tissue haemorrhage and compliance loss, even though pulmonary capillary permeability was maintained near base line rates[13]. The oxidative stress imposed on lung tissue, as seen by high levels of lipid peroxidation, after brain injury was significantly attenuated by MPSS treatment. MPSS treatment following brain injury also augmented putative anti-apoptotic bcl-2 gene expression in lung tissue[14]. But in this study, we did not observe any correlation between the MPSS treatment group and survivin and aven expression ratios.
In addition to the most popular bcl-2 family which plays a significant role in aspects of cell death and survival, another group of proteins were also found to play a prominent role in the inhibition[5,6,15,16].The most prominent member of this family is survivin, which has been characterized as a bifunctional protein and is involved in suppression of apoptosis and cell division. Despite the redundancy of cell-death pathways, current evidence suggests that over-expression of survivin becomes a requirement to preserve cell viability[16].
Aven is a conserved protein that has broad tissue distribution with prominent expression in heart, skeletal muscle, kidney, liver, pancreas, testis, and several established cell lines. Aven interferes with the ability of Apaf-1 to self-associate, and subsequent inhibition of Apaf-1 mediated activation of caspases[17].
Increased survivin expression in response to cytokines raises the intriguing possibility that bcl-2 and survivin may represent complementary survival pathways that are differentially regulated by the cell-cycle status. Although they act at different levels, it has been shown that two survival pathways, bcl-2 and survivin, may function in concert to prevent cell death[16]. This finding was also supported in our study.
The results in our study provided the first experimental evidence for a potential role of EPO to protect the lung tissue by increasing the survivin and aven gene expressions after TBI. This observed phenomenon we think is extremely important for clinical purposes. Based on these results, we recommend comparative studies to evaluate the role of antiapoptotic signals survivin and aven in the management of lung cell death. This may be of value in preventing donor lung after TBI.
REFERENCES
1. Natale JE, Ahmed F, Cernak I, et al. Gene expression profile changes are commonly modulated across models and species after traumatic brain injury. J Neurotrauma,2003, 20: 907-927.
2. Gamberoni C, Colombo G, Aspesi M, et al. Respiratory mechanics in brain injured patients. Minerva Anestesiol,2002,68: 291-296.
3. Yildirim E, Kaptanoglu E, Ozisik K, et al. Ultrastructural changes in pneumocyte type Ⅱ cells following traumatic brain injury in rats. Eur J Cardiothorac Surg,2004,25: 523-529.
4. Deveraux QL, Reed JC. IAP family proteins-suppressors of apoptosis. Genes Dev，1999，13: 239-252.
5. Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, et al. IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res,1998,58: 5315-5320.
6. Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindles checkpoint by survivin. Nature,1998,396: 580-584.
7. Chau BN, Cheng EHY, Kerr DA,et al.Aven, a novel inhibitor of caspase activation, binds Bcl-x(L) and Apaf-1. Mol Cell,2000,6: 31-40.
8. Mantell LL, Lee PJ. Signal transduction pathways in hyperoxia-induced lung cell death. Mol Genet Metab,2000,71: 359-370.
9. Jelkmann W. Erythropoietin: Structure, control of production, and function. Physiol Rev,1992,72: 449-489.
10. Eid T, Brines M. Recombinant human erythropoietin for neuroprotection: what is the evidence? Clin Breast Cancer,2002,3 Suppl 3, S109-S115.
11. Yildirim E, Ozisik K, Solaroglu I,et al. Protective effect of erythropoietin on type Ⅱ pneumocyte cells after traumatic brain injury in rats. J Trauma,2005,58:1252-1258.
12. Yildirim E, Solaroglu I, Okutan O, et al. Ultrastructural changes in tracheobronchial epithelia following experimental traumatic brain injury in rats: protective effect of erythropoietin. J Heart Lung Transplant ,2004,23:1423-1429.
13. Edmonds HL Jr, Cannon HC Jr, Garretson HD, et al. Effects of aerosolized methylprednisolone on experimental neurogenic pulmonary injury. Neurosurgery,1986,19: 36 -40.
14. Yildirim E, Ozisik K, Ozisik P, et al. Apoptosis-related gene bcl-2 in lung tissue after experimental traumatic brain injury in rats.Heart Lung Circ,2006,15:124-129.
15. Santini D, Abbate A, Scarpa S, et al. Surviving acute myocardial infarction: survivin expression in viable cardiomyocytes after infarction. J Clin Pathol,2004,57:1321-1324.
16. Altieri DC. The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trends Mol Med,2001,7. 542-547.
17. Carter BZ, Milella M, Altieri DC, et al. Cytokine-regulated expression of survivin in myeloid leukemia. Blood,2001,97:2784-2790.
1 Department of Thoracic and Cardiovascular Surgery, Ankara Numune Education and Research Hospital, Ankara, Turkey
2 Department of Neurosurgery, Hacettepe University, Ankara, Turkey
3 Metis Biotechnology, Co.Ltd, Ankara, Turkey
(Editor Emilia)(Bulent Kocer1, Erkan Yild)
Tel: +90-505- 2901885,Fax: +90-312-3170353,E-mail: sozisik2002@yahoo.comwere to investigate the two anti-apoptotic signals survivin and aven in rat lung tissue after TBI to assess the protection of the lung from secondary injury conferred by MPSS and EPO comparatively.
[Abstract]ObjectiveWe have recently shown that experimental traumatic brain injury (TBI) results in ultrastructural damage in lung tissue. The aim of this study was to determine the two anti-apoptotic signals survivin and aven in rat lung tissue following TBI and compare the effect of erythropoietin (EPO) and methylprednisolone (MPSS). MethodsThirty-six Wistar-Albino female rats weighing 190~230 g were used, which were allocated into 6 groups. Group 1 received head trauma and no treatment. Group 2 and Group 3 received head trauma and intraperitoneally 1000 IU/kg EPO and MPSS (30 mg/kg), respectively. Group 4 (vehicle), received head trauma and intraperitoneally albumin (0.4 ml/rat). Group 5 and 6 were the control and sham operated groups, respectively. A weight-drop method was used to achieve head trauma. Real-time quantitative polymerase chain reaction was used for both survivin and aven gene expression at the total RNA level.ResultsBoth survivin and aven were higher in the EPO treatment group than in the trauma group (P<0.05,P<0.05, respectively). When we compared survivin and aven between EPO and MPSS groups, there was no important association (P>0.05,P>0.05, respectively). Also both survivin and aven were significantly higher in the EPO treatment group than vehicle, control and sham-operated groups. ConclusionsThese findings suggest that EPO may play an important role in the expression of antiapoptotic survivin and aven genes in the lung tissue after TBI.
[Key words] survivin;aven;erythropoietin;methylprednisolone;lung;head injuries
INTRODUCTION
Brain trauma is a major cause of morbidity and mortality, both in adult and paediatric populations. Much of the functional deficit derives from delayed cell death resulting from induction of neurotoxic factors that overwhelm endogenous neuroprotective responses[1]. Brain injured patients have an increased risk of extracerebral organ failure, mainly pulmonary dysfunction[2]. In our previous study, we have shown that experimental TBI causes obvious gradual injury on ultrastructure of the type Ⅱ pneumocytes[3]. Pathophysiology of lung tissue injury after severe TBI must be well understood, including the apoptotic processes.
A member of the inhibitor of apoptosis (IAP) gene family[4], survivin also known as Birc5, has been demonstrated to have a unique, dual role in the regulation of cell proliferation and cell death. Elevated levels of survivin are found in human fetal lung, liver, heart, kidney and gastrointestinal tract. Survivin prevents apoptosis by blocking caspase activity and it is expressed as the G2/M phase of the cycle[5,6].
A new intracellular membrane protein, aven,has now been shown to bind both bcl-xL and Apaf-1. Aven is broadly expressed and is conserved in mammalian species. It suppresses apoptosis induced Apaf-1 and caspase-9. Thus, aven represents a new class of cell death regulator[7].
The ability of potentially therapeutic agents to induce the expression of survivin and aven proteins might provide a new avenue for therapy to prevent lung tissue damage after TBI. Therefore, our aims in this study
MATERIALS AND METHODS
All animals received humane care in compliance with “the Guide for the Care and Use of Laboratory Animals” (National Institutes of Health, USA, Publication No. 85-23, revised 1996). The Animal Care Committee of the Ankara Hospital approved the protocols used in this study. The rats were randomly allocated into 6 groups and all groups contained 6 rats.
Trauma group: TBI of 300 g-cm was produced.
Erythropoietin group: r-Hu-EPO (1000 IU/kg; Eprex, Cilag AG, Zug, Switzerland) was administered intraperitoneally immediately after TBI.
Methylprednisolone group: MPSS in a dose of 30 mg/kg was administered intraperitoneally immediately after TBI.
Vehicle group: Albumin; intraperitoneally-bolus (0.4 ml/rat) directly after trauma.Control group: Tissue samples immediately after thoracotomy; no head surgery.
Sham operated group: Scalp was closed after craniotomy; no trauma. Tissue samples were obtained 24 hours after induced trauma in all groups, except the control group.
Surgical Procedure
The surgical procedure was performed under general anaesthesia induced by intramuscular xylasine (Bayer, Istanbul, Turkey) (10 mg/kg) and ketamine hydrochloride (Parke Davis, Istanbul, Turkey) (60 mg/kg) injections. Rats each were placed in prone position. Right frontoparietal craniectomies were carried out lateral to the sagittal sinus by dental drill system. The dura was exposed and left intact. Trauma was induced according to the study recently done by our research team[3]. Body temperature was continuously monitored with a rectal thermometer and maintained at 37 ℃ using a heating pad and an overhead lamp. Rats were not intubated. They were given free access to food and water. None of the animals died during the study period. But severe injured animals which had no treatment were very sick and hypoactive at the end of the 24 hours.
Obtaining Samples from Lung Parenchyma
Twenty-four hours after TBI for all groups except the control group, rats were re-anaesthetized. Midline sternotomy and bilateral thoracotomy were performed. The systemic circulation was perfused with 0.9% NaCl. Then, rats were killed with decipitation under general anaesthesia. Samples were all obtained from the left pulmonary lobes. Samples were collected in randomly numbered containers and given to the blinded observers. After evaluating the numbered tissues, results were collected in the appropriate group lists.
Isolation of RNA and Synthesis of cDNA
Samples were immediately frozen in liquid nitrogen at -80°C. Total RNA of each lung tissues isolated using a high pure RNA tissue kit (Roche Diagnostics, Germany) were assessed for RNA integrity electrophoretically verified with ethidium bromide staining and by OD260/OD280 nm absorption ratio >1.95. One μg of total RNA was used for cDNA synthesis using first strand cDNA synthesis kit for RT-PCR (AMV) (Roche Diagnostics, Germany) according to the manufacturer’s protocol.
Quantitative Real-Time PCR Analysis
Real-time quantitative PCR was performed to assess transcripts of aven and survivin relative to the housekeeping gene b-actin. The cDNA was used for quantitative real-time PCR amplification with SYBR Green I chemistry (Roche Applied Sciences, Germany). Primers were designed using Primer Premier 5 software (Premier Biosoft International, USA). Aven primers were F 5′ GACTTCAGTGTCCTCTTGAG 3′ and R 5′ CCTTGCCATCATCGTTTCTC 3′ (GenBank Acc. no. XM230438), survivin primers were F 5′ GCCACTTGTCCCAGCTTTCC 3′ and R 5′ GTCACAATAGAGCAAAGCCACA 3′ (GenBank Acc. no. AF276775) and b-actin primers were 5’ TCTTTAATGTCACGCACGATT 3’ and 5’ TCACCCACACTGTGCCCAT ’ (GenBank Acc. no. XM230438). The real-time PCR reactions were carried out in a total volume of 10 μl with 0.5 mM of each primers and MgCl2 4 mM using FastStart DNA Master SYBR Green I kit (Roche Applied Sciences, Germany). The b-actin mRNA was quantified to adjust the amount of mRNA in each sample with b-actin primer set.
The cycling parameters were 10 min at 95°C for activating hot start Taq polymerase, 45 cycles of 10 seconds at 95°C, 5 seconds at 60°C for amplification and quantification, 10 seconds at 72°C and 0 seconds at 80°C for extension. Fluorescence readings were performed at 84°C every cycle to prevent fluorescence from primer dimers. The specificity of all individual amplification reactions was confirmed by melting curve analysis. The assays used b-actin as the endogenous internal housekeeping gene that revealed less variability and better reproducibility in our method. Real-time expression values were calculated using the relative standard curve method. Standard curves were generated for each mRNA using 10-fold serial dilutions for both the target of interest and the endogenous control (b-actin) by measuring the cycle number at which exponential amplification occurred in a dilution series of samples. Values were normalized to the relative amounts of b-actin mRNA, which were obtained from a similar standard curve. In real-time PCR reactions the same initial amounts of target molecules were used, and the Cp values of b-actin mRNA were constant in all samples.
Statistical Analysis
Data are reported as mean values ± standard deviation (SD). Two-tailed Student’s t tests were used for two group comparisons. Differences with P values less than 0.05 were regarded as statistically significant.
RESULTS
Survivin expression ratios measured in the cardiac myocytes samples in all groups (Figure 1). Intraperitoneal administration of EPO produced a significant increase in the survivin expression (P<0.05) compared with trauma group suggested that EPO has anti-apoptotic effect in lung tissue after TBI. These results showed no statistically significant difference in survivin expression ratios between EPO and MPSS treatment groups. Treatment with vehicle solution did not produce a significant increase in the survivin expression in lung tissue after TBI (P>0.05).
Intraperitoneal administration of EPO produced a significant increase in the aven expression (P<0.05) compared with trauma group suggested that EPO has anti-apoptotic effect in lung tissue after TBI (Figure 2). These results showed no statistically significant difference in aven expression ratios between EPO and MPSS treatment groups. The difference between trauma and vehicle-treated group was not statistically significant (P>0.05).
Also, these results provided that there was no statistically significant differences of survivin and aven levels between control and sham groups, respectively.
Figure 1 Figure shows survivin expression ratios measured in the lung tissue samples in all groups. EPO produced a significant increase in the survivin expression (P<0.05) compared with trauma group indicating preservation of lung. When we compared survivin expression ratios between EPO and MPSS treatment groups, there was no important association (P<0.05). Note that vehicle solution did not produce a significant increase in the survivin expression in lung tissue after TBI (P>0.05)
Figure 2Figure shows aven expression ratios measured in the lung tissue samples in all groups. EPO produced a significant increase in the aven expression compared with trauma group indicating preservation of lung. When we compared aven expression ratios between EPO and MPSS treatment groups, there was no important association (P>0.05). Note that the difference between trauma and vehicle-treated group was not statistically significant (P>0.05)
DISCUSSION
Increasing evidence suggests that pulmonary dysfunction resulting from acute oxygen toxicity is at least in part due to the injury and death of lung cells. Studies using morphological and biochemical analyses revealed that hyperoxia-induced pulmonary cell death is multimodal, involving not only necrosis, but also apoptosis. A correlative relationship between the severity of hyperoxic acute lung injury and increased apoptosis has been supported by numerous studies in a variety of animal models. Cell death and lung injury are associated with increased expression of several apoptotic regulatory proteins such as p53 and bcl-2, and DNA damage-induced proteins[8].
It seems there is not a single mechanism to be accepted occurring after TBI as stated in detail belove.
EPO is a hematopoietic growth factor that stimulates proliferation and differentiation of erythroid precursor cells[9]. Recent studies have made known the significance of the non-erythropoietic effects of EPO. EPO is an endogenous cytokine with anti-apoptotic, anti-inflammatory, and neurotrophic properties[10].It has been revealed that EPO protects the ultrastructure of pneumocyte type Ⅱ cells and tracheobronchial epithelia against damage after TBI [11,12].
MPSS has been shown to have a biphasic effect on alveolar capillary integrity after elevated cerebrospinal fluid pressure, whereby low dose MPSS minimized the extent of lung haemorrhage, pulmonary capillary leakage, and loss of lung compliance. In contrast, MPSS high dose accelerated tissue haemorrhage and compliance loss, even though pulmonary capillary permeability was maintained near base line rates[13]. The oxidative stress imposed on lung tissue, as seen by high levels of lipid peroxidation, after brain injury was significantly attenuated by MPSS treatment. MPSS treatment following brain injury also augmented putative anti-apoptotic bcl-2 gene expression in lung tissue[14]. But in this study, we did not observe any correlation between the MPSS treatment group and survivin and aven expression ratios.
In addition to the most popular bcl-2 family which plays a significant role in aspects of cell death and survival, another group of proteins were also found to play a prominent role in the inhibition[5,6,15,16].The most prominent member of this family is survivin, which has been characterized as a bifunctional protein and is involved in suppression of apoptosis and cell division. Despite the redundancy of cell-death pathways, current evidence suggests that over-expression of survivin becomes a requirement to preserve cell viability[16].
Aven is a conserved protein that has broad tissue distribution with prominent expression in heart, skeletal muscle, kidney, liver, pancreas, testis, and several established cell lines. Aven interferes with the ability of Apaf-1 to self-associate, and subsequent inhibition of Apaf-1 mediated activation of caspases[17].
Increased survivin expression in response to cytokines raises the intriguing possibility that bcl-2 and survivin may represent complementary survival pathways that are differentially regulated by the cell-cycle status. Although they act at different levels, it has been shown that two survival pathways, bcl-2 and survivin, may function in concert to prevent cell death[16]. This finding was also supported in our study.
The results in our study provided the first experimental evidence for a potential role of EPO to protect the lung tissue by increasing the survivin and aven gene expressions after TBI. This observed phenomenon we think is extremely important for clinical purposes. Based on these results, we recommend comparative studies to evaluate the role of antiapoptotic signals survivin and aven in the management of lung cell death. This may be of value in preventing donor lung after TBI.
REFERENCES
1. Natale JE, Ahmed F, Cernak I, et al. Gene expression profile changes are commonly modulated across models and species after traumatic brain injury. J Neurotrauma,2003, 20: 907-927.
2. Gamberoni C, Colombo G, Aspesi M, et al. Respiratory mechanics in brain injured patients. Minerva Anestesiol,2002,68: 291-296.
3. Yildirim E, Kaptanoglu E, Ozisik K, et al. Ultrastructural changes in pneumocyte type Ⅱ cells following traumatic brain injury in rats. Eur J Cardiothorac Surg,2004,25: 523-529.
4. Deveraux QL, Reed JC. IAP family proteins-suppressors of apoptosis. Genes Dev，1999，13: 239-252.
5. Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, et al. IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res,1998,58: 5315-5320.
6. Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindles checkpoint by survivin. Nature,1998,396: 580-584.
7. Chau BN, Cheng EHY, Kerr DA,et al.Aven, a novel inhibitor of caspase activation, binds Bcl-x(L) and Apaf-1. Mol Cell,2000,6: 31-40.
8. Mantell LL, Lee PJ. Signal transduction pathways in hyperoxia-induced lung cell death. Mol Genet Metab,2000,71: 359-370.
9. Jelkmann W. Erythropoietin: Structure, control of production, and function. Physiol Rev,1992,72: 449-489.
10. Eid T, Brines M. Recombinant human erythropoietin for neuroprotection: what is the evidence? Clin Breast Cancer,2002,3 Suppl 3, S109-S115.
11. Yildirim E, Ozisik K, Solaroglu I,et al. Protective effect of erythropoietin on type Ⅱ pneumocyte cells after traumatic brain injury in rats. J Trauma,2005,58:1252-1258.
12. Yildirim E, Solaroglu I, Okutan O, et al. Ultrastructural changes in tracheobronchial epithelia following experimental traumatic brain injury in rats: protective effect of erythropoietin. J Heart Lung Transplant ,2004,23:1423-1429.
13. Edmonds HL Jr, Cannon HC Jr, Garretson HD, et al. Effects of aerosolized methylprednisolone on experimental neurogenic pulmonary injury. Neurosurgery,1986,19: 36 -40.
14. Yildirim E, Ozisik K, Ozisik P, et al. Apoptosis-related gene bcl-2 in lung tissue after experimental traumatic brain injury in rats.Heart Lung Circ,2006,15:124-129.
15. Santini D, Abbate A, Scarpa S, et al. Surviving acute myocardial infarction: survivin expression in viable cardiomyocytes after infarction. J Clin Pathol,2004,57:1321-1324.
16. Altieri DC. The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trends Mol Med,2001,7. 542-547.
17. Carter BZ, Milella M, Altieri DC, et al. Cytokine-regulated expression of survivin in myeloid leukemia. Blood,2001,97:2784-2790.
1 Department of Thoracic and Cardiovascular Surgery, Ankara Numune Education and Research Hospital, Ankara, Turkey
2 Department of Neurosurgery, Hacettepe University, Ankara, Turkey
3 Metis Biotechnology, Co.Ltd, Ankara, Turkey
(Editor Emilia)(Bulent Kocer1, Erkan Yild)