Carnosine as a Protective Factor in Diabetic Nephropathy
http://www.100md.com
糖尿病学杂志 2005年第8期
1 Institute of Human Genetics Heidelberg, Heidelberg, Germany
2 Department of Nephrology, Endocrinology and Rheumatology, Fifth Medical Clinic, Mannheim, Germany
3 First Department of Pediatrics, University Hospital Heidelberg, Heidelberg, Germany
4 Second Department of Medicine and Departement of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague, Czech Republic
5 Department of Pathology, Leiden University Medical Centre, Leiden, the Netherlands
6 Department of Internal Medicine, University Medical Centre Groningen, Groningen, the Netherlands
7 Hamad Medical Corporation, Doha, Qatar
8 Service de Nephrologie A, Hopital Tenon, Institut National de la Santee et de la Recherche Medicalee, Paris, France
9 Academic Renal Unit, Southmead Hospital, Bristol, U.K
10 Department of Endocrinology and Nephrology, Third Medical Clinic, Heidelberg, Germany
ABSTRACT
The risk of diabetic nephropathy is partially genetically determined. Diabetic nephropathy is linked to a gene locus on chromosome 18q22.3-q23. We aimed to identify the causative gene on chromosome 18 and to study the mechanism by which the product of this gene could be involved in the development of diabetic nephropathy. DNA polymorphisms were determined in 135 case (diabetic nephropathy) and 107 control (diabetes without nephropathy) subjects. The effect of carnosine on the production of extracellular matrix components and transforming growth factor- (TGF-) after exposure to 5 and 25 mmol/l D-glucose was studied in cultured human podocytes and mesangial cells, respectively. A trinucleotide repeat in exon 2 of the CNDP1 gene, coding for a leucine repeat in the leader peptide of the carnosinase-1 precursor, was associated with nephropathy. The shortest allelic form (CNDP1 Mannheim) was more common in the absence of nephropathy (P = 0.0028, odds ratio 2.56 [95% CI 1.36eC4.84]) and was associated with lower serum carnosinase levels. Carnosine inhibited the increased production of fibronectin and collagen type VI in podocytes and the increased production of TGF- in mesangial cells induced by 25 mmol/l glucose. Diabetic patients with the CNDP1 Mannheim variant are less susceptible for nephropathy. Carnosine protects against the adverse effects of high glucose levels on renal cells.
Diabetic nephropathy is one of the most severe complications of type 1 and type 2 diabetes. Diabetic nephropathy has become the leading cause of end-stage renal failure in the western world. In the U.S., the number of cases of end-stage renal failure due to diabetic nephropathy continues to increase at almost 10% per year (1).
There is a large body of evidence (2,3) of familial aggregation of diabetic nephropathy, and the existence of at least one genetic susceptibility factor seems likely. The most intensively studied genetic variant is the "D/I" polymorphism in the ACE gene on chromosome 17 encoding the angiotensin converting enzyme. Meta-analyses (4eC6) have suggested a weak association between the presence of the D-allele and diabetic nephropathy.
In 2002, our group presented results of a family-based linkage study on 18 Turkish families with type 2 diabetes showing that a major susceptibility locus maps to chromosome 18q22.3-q23 (7). The locus was mapped between the markers D18S43 and D18S50 and was supported by a highly significant logarithm of odds score of 6.1. Linkage of diabetic nephropathy to 18q was confirmed by an affected sibpair analysis performed on Pima Indians and, very recently, by a large sibpair analysis of African Americans (7,8). We postulated that diabetic nephropathy might be caused by a dominant-acting mutation at this gene locus. Consequently, a recessive allele at this locus could protect carriers from the development of this complication. ZNF236 is the only gene within the 18q candidate region that had previously been considered as a candidate gene for diabetic nephropathy (9). Since no mutations in the transcript of the gene were found, ZNF236 was subsequently excluded as a trait-causing gene (10). It therefore remained unknown which gene within the 18q region is responsible for the susceptibility of some diabetic subjects to develop diabetic nephropathy. We searched for genes related to the pathophysiology of microvascular disease and focused on the inhibition of oxidative stress and advanced glycation end products (AGEs). For example, AGEs have been found in glomeruli of diabetic animals and humans, the inhibition of AGEs is beneficial in experimental diabetic nephropathy, and AGEs have been shown to cause impaired proliferation of renal mesangial cells, a major feature of diabetic nephropathy development (11). The carnosinase genes CNDP1 and CNDP2 are such genes located in 18q22.3.
The enzyme carnosinase degrades the dipeptide carnosine (-alanyl-L-histidine), while carnosine has been reported to inhibit the formation of AGE molecules (12). CNDP1 encodes the secreted serum carnosinase, whereas CNDP2 encodes tissue carnosinase, also known as cytosolic nonspecific dipeptidase (13). The genes are positioned adjacent to each other in a head-to-tail orientation. The aim of this study was to identify the causative gene on chromosome 18 and to gain insight in the mechanism by which the product of this gene could be involved in the development of diabetic nephropathy.
RESEARCH DESIGN AND METHODS
Sampling strategy for case-control study.
We screened 5,500 patient records in different centers in Germany, The Netherlands, Qatar, and the Czech Republic. A complete list of participating centers can be found in the contributors section of the ACKNOWLEDGMENTS. To identify case and control subjects, screening of all patient records of a participating center was performed, and patients not fulfilling the inclusion criteria were excluded. The detailed sampling strategy, exclusion and inclusion criteria, and details on collected data are given in the addendum available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791.
Power analysis.
Single type 2 and type 1 diabetic patients (designated groups 2 and 3, respectively) were recruited for confirmatory testing of the sequence variant selected in the first phase (an explorative search using group 1). Together, groups 2 and 3 consisted of 99 patients with diabetes and 98 patients with diabetic nephropathy. Power estimations had shown that such a sample size would be sufficient to confirm association with >80% power if the relative risk exceeds 2.5 (allele frequency 40eC50%, significance level 5%).
Sequence analysis and genotyping.
CNDP1 exons were amplified using intronic primers (MWG-Biotech, Ebersberg, Germany) and sequenced using an ABI 3100 capillary sequencer (Applied Biosystems, Darmstadt, Germany). Sequence analysis of the CNDP2 gene was performed by Synergene (Qormi, Malta). Techniques used for PCR-based genotyping of polymorphisms included restriction enzyme digest (rs2278161), fragment analysis using an ALF-Express DNA sequencer (Pharmacia-Biotech, Freiburg, Germany) (D18S58, rs10548323, rs3080862, DN31, rs10596720, D18S880, and D18S1161), TaqMan single nucleotide polymorphism genotyping using an ABI Prism 7000 (Applied Biosystems) (rs12965928 and rs2241509), denaturing high-performance liquid chromatography analysis (Transgenomic, Berlin, Germany) (rs1046407 and rs22778156), or sequence analysis (rs1559803, rs7237740, rs3764509, rs890332, rs4892247, and rs2887). Primer sequences are available on request. For D18S880, we used a standard PCR protocol with primers AGGCAGCTGTGTGAGGTAAC (forward) and GGGTGAGGAGAACATGCC (reverse). The annealing temperature was 60°C. Sequence analysis confirmed that a PCR product length of 167 corresponds to 5 CTG repeat units (five leucine codons).
Measurement of carnosine and carnosinase activity in serum.
For measurement of serum-carnosinase activity, serum samples were withdrawn between 9:00 and 10:00 A.M., cooled on ice immediately, and stored at eC80°C. A total of 150 e蘬 carnosine (1 mg/ml in 50 mmol/l Tri-HCl buffer) (Sigma Aldrich Chemie, Deisenhofen, Germany) was added to 600 e蘬 serum, divided into aliquots of 100 e蘬, and incubated at 30°C. The reaction was stopped after 5, 10, 15, 20, 30, and 40 min by adding 25 e蘬 10% 5-sulfosalicylic acid (Sigma Aldrich Chemie). After shaking, the samples were incubated at 4°C for 30 min and centrifuged at 13,000 rpm for 5 min to remove the precipitated proteins. Carnosine concentrations were assayed by fluorometic determination after derivatization with carbazole-9-carbonyl chloride. Separation was performed by liquid chromatography according to the method described by Schonherr (14).
In vitro studies
Cell culture.
Human SV 40eCtransformed mesangial cells as well as human thermosensitive SV 40eCtransformed podocytes were used to investigate the influence of L-carnosine on the increased production of extracellular matrix proteins and transforming growth factor- (TGF-)1 and -2 under hyperglycemic conditions. SV 40eCtransformed, temperature-sensitive podocytes were characterized as previously described (15). These cells proliferate at the "permissive" temperature (33°C). After transfer to the "nonpermissive" temperature (37°C), they enter growth arrest and express markers of differentiated in vivo podocytes, including nephrin, podocin, CD2AP, and synaptopodin. Human SV 40eCtransformed mesangial cells were characterized as previously described (16). All cell lines were cultivated in uncoated culture flasks in Dulbecco’s modified Eagle’s medium (PAA, Coelbe, Germany) supplemented with 10% FCS (Greiner, Frickenhausen, Germany), insulin-transferin selenium (all in concentrations of 5 ng/ml), epidermal growth factor (5 ng/ml), and penicillin/streptomycin (10 units/ml, all from Sigma, St. Louis, MO). Methods for indirect immunofluorescence, TGF-1 and -2, enzyme-linked immunosorbent assays, RNA isolation, and real-time PCR on human glomeruli, CNDP1 antibodies, and immunohistochemistry are available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791.
Computer analyses and statistical tests.
We used the PSORT II program (19) for functional analysis of 5' sequences (calculation of G. von Heijne [GvH] scores). Statistical analyses were performed with SAS V8.02 (PC version). Fisher’s exact test and 2 analyses were performed to test for association within each population group. The Mantel-Haenszel test was used to analyze data obtained from multiple populations. The Wilcoxon rank-sum test was used to compare groups of samples. P values <0.05 were regarded as significant.
RESULTS
Patient data.
A total of 5,500 patient files were screened to identify the patients included in this study. One hundred thirty-five patients with diabetic nephropathy and 107 diabetic patients without diabetic nephropathy were selected for the study. The most common cause for exclusion was microalbuminuria (30%). An equal number of patients had normoalbuminuria but a diabetes duration of <15 years. Six percent had normoalbuminuria and a sufficient diabetes duration but were on an ACE inhibitor or angiotensin II receptor 1 antagonist, which they were not willing to stop for reevaluation of albuminuria. Four percent of macroalbuminuric and diabetic dialysis patients had to be excluded because they did not have diabetic retinopathy at the onset of renal disease. Other types of diabetes (e.g., gestational diabetes or diabetes due to pancreatic disease) led to the exclusion of 10% of patients. Another 10% were unwilling to participate or unable to give informed consent. Missing data were the reason for exclusion in only 6% of patients. For exact numbers on excluded patients and decision making on inclusion and exclusion see the addendum of this article available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791. If we compared the number of excluded patients per center, a similar pattern of exclusion was observed for each center. Demographic data and medication of the included patients are given in Tables 1 and 2.
Sequence analysis of coding regions.
All 12 exons of the CNDP1 gene, all 12 exons of the CNDP2 gene, and the intronic regions flanking these exons were completely sequenced in three German patients with diabetic nephropathy and in two German patients without diabetic nephropathy after 15 years of diabetes. All patients had type 2 diabetes. Several polymorphic sequence variants were detected (Table 3), but no truncating or obviously obliterating mutations were identified.
Association analysis.
We performed an explorative search for polymorphisms associated with the diabetic nephropathy trait upon the first group of patients: the "trio-group" (37 patients with type 2 diabetes and diabetic nephropathy and 8 diabetic control subjects). All polymorphisms listed in Table 3 were tested. The most significant association was found with marker D18S880, a trinucleotide repeat in CNDP1 exon 2. Since this polymorphism lies in the 5' coding part of the transcript, the number of trinucleotide repeats is directly related to the number of leucine residues in the leader peptide of the carnosinase precursor: five, six, or seven leucines. The five-leucine allele was found on 88% of chromosomes in patients without diabetic nephropathy but had an allele frequency of only 59% in the diabetic nephropathy group. In contrast to diabetic nephropathy patients, most patients without diabetic nephropathy were homozygous for this allele (P = 0.041) (odds ratio 5.54 [95% CI 0.98eC31.45]). The genotype frequencies are given in Table 4. Since the first individual found to be homozygous for the five-leucine allele came from the city of Mannheim, we designated this allele the "CNDP1 Mannheim allele."
The second patient group consisted of patients with type 2 diabetes with (n = 77) and without (n = 63) diabetic nephropathy from Germany, The Netherlands, Qatar, and the Czech Republic. In this group, we tested whether homozygosity for the CNDP1 Mannheim allele was less frequent among patients with diabetic nephropathy compared with patients without the complication. A significant difference was confirmed, with only 20 of 77 diabetic nephropathy cases being homozygous for the Mannheim allele compared with 25 of 63 cases without diabetic nephropathy (P = 0.024, single-sided Mantel-Haenszel test). The frequencies of the observed genotypes are shown in Table 4. There was no evidence of heterogeneity between the four populations.
In a third group, it was tested whether the predominance of the Mannheim allele in diabetic nephropathyeCresistant patients also applies to type 1 diabetes. Homozygosity for the Mannheim allele was found in only 4 of 21 (19%) patients with diabetic nephropathy, compared with 15 of 36 (42%) case subjects without nephropathy (P = 0.098). Combined analysis of this group with the type 2 diabetic groups mentioned above showed an odds ratio of 2.56 (95% CI 1.36eC4.84) (P = 0.0028). As shown in Table 4, the distribution of D18S880 genotypes is very similar among diabetic nephropathy patients with type 1 and type 2 diabetes; the Mantel-Haenszel test showed no evidence for heterogeneity.
Sequence comparisons on CNDP1 leader peptide.
The leader peptide at the NH2-terminal end of the serum-carnosinase precursor protein has only little homology to the consensus pattern, as published by von Heijne (20). The GvH score, used to measure homology to the consensus, is the original weight-matrix score introduced by von Heijne subtracted by 3.5. The seven-leucine allele showed a GvH score of 0.83, whereas the CNDP1 Mannheim allele showed a GvH score of eC1.76 (Fig. 1A).
Measurement of serum carnosinase activity in normal volunteers.
Serum-carnosinase activities and leucine repeat D18S880 genotypes were determined in 45 healthy volunteers. The enzyme activities (12eC46 nmol · mleC1 · heC1, mean 26.6) were plotted against the genotype (Fig. 1B). There is a clear correlation between leucine repeat number and serum-carnosinase activity (P = 0.018). The lowest activity is associated with homozygosity for the five-leucine allele. This suggests that six and seven leucine alleles can be regarded as gain-of-function mutations associated with a higher enzyme activity. Despite the immediate stabilization of serum carnosine after blood withdrawal, the measured carnosine levels were very low. In the control subjects, the carnosine concentrations ranged from 0.08 to 0.81 eol/l (mean 0.33) and are close to our detection threshold.
Confirmation of the protective role of carnosine by cell culture experiments.
Carnosine inhibited the effects of high glucose on cultured human podocytes (Fig. 2) and on cultured human mesangial cells (Fig. 3). The addition of carnosine blocked the glucose-induced increase in production of extracellular matrix components fibronectin and collagen type VI by podocytes and of TGF-2 in mesangial cells. TGF-1 production was not influenced by the addition of glucose or carnosine (data not shown).
CNDP1 expression in kidneys.
Real-time measurement of CNDP1 expression was performed on isolated glomeruli from four healthy kidneys and three diabetic nephropathy kidneys. The relative expression of CNDP1 mRNA in glomeruli from patients with diabetic nephropathy was 1.0 (range 0.4eC1.4) and 2.9 (2.7eC3.4) in control glomeruli.
Human kidney specimens from seven patients with diabetic nephropathy and five from control individuals (three pretransplantation biopsies, two from patients after undergoing tumor-related nephrectomy) were stained for CNDP1 using two different antibodies (C17E and Y18K). Both antibodies revealed a similar staining pattern for CNDP1. Representative stainings using C17E are depicted in Fig. 4. The stainings show CNDP1 expression especially in podocytes and confirm an elevated expression in all kidneys from patients with diabetic nephropathy.
DISCUSSION
This study shows that a repeat expansion in the leader peptide of the CNDP1 gene is associated with susceptibility for diabetic nephropathy in patients with type 1 and type 2 diabetes. Diabetic patients with two copies of CNDP1 Mannheim, the gene variant with the lowest number of leucine repeats in the leader peptide, are less susceptible to diabetic nephropathy. Our data confirm that susceptibility for diabetic nephropathy is a dominant trait.
We stringently excluded from this study patients with an unclear cause of renal damage, such as patients with microalbuminuria, patients in which protein excretion was only determined while they were on ACE inhibitors or ATR1 blockers, and patients without renal symptoms with a duration of diabetes <15 years. The patients in this study were white and from central and western Europe or the Middle East. These findings therefore confirm and extend earlier data obtained in Turkey, in North-American Pima Indians, and in African-American patients (7,8).
As we hypothesized, individuals with a higher number of CNDP1 leucine repeats in the leader peptide had higher serum carnosinase activity levels. Our in vitro data strengthen the plausibility of our hypothesis: the substrate of the enzyme encoded by the CNDP1 gene, carnosine, protects renal cells against the deleterious effects of high glucose levels. The carnosine concentrations used in the cell culture experiments are in the same order of magnitude as has been reported in tissues of long-lived species (12). The read-out parameters of the in vitro studies are relevant: the ED-A domains of fibronectin and collagen type VI are known to accumulate in human diabetic nephropathy (21eC23), and several in vitro and in vivo studies (24eC27) have implicated mesangial TGF- as a key mediator in diabetic renal disease. In our experiments, glucose only induced TGF-2, not -1, in cultured human mesangial cells. Hill et al. (28) have suggested that TGF-2 is closely linked to fibrogenesis in diabetic nephropathy.
Carnosine, -alanyl-L-histidine, was first described in 1900 and functions as a natural ACE inhibitor (29,30), a natural radical oxygen species (ROS) scavenger (31), an AGE breaker (32), and, thus, as a natural antiaging substance (29). The mitochondrial overproduction of ROS has been demonstrated to be fundamental in the vascular pathobiology of diabetic microvascular complications (33). In light of the properties of carnosine, it is important to note that several studies have also shown that pharmacologic inhibition of the renin-angiotensin system effectively delays disease progression in patients with diabetic nephropathy (34,35), that binding of AGEs to the receptor for AGEs is thought to mediate the release of ROS in mesangial cells in kidneys with diabetic nephropathy (36), and that nondiabetic parents of children with diabetic nephropathy have been reported to die earlier than parents of diabetic children without nephropathy (37). Because AGEs induce the production of angiotensin II in mesangial cells and carnosine may function as an ACE inhibitor (30,36), our results are compatible with the notion that the renin-angiotensin system plays a crucial role in the pathogenesis of diabetic nephropathy (rev. in 38). It remains to be determined where in the cascade of AGEeCreceptor for AGE binding, ROS generation, activation of TGF-eCSmad signaling, fibronectin synthesis, and autocrine production of angiotensin II carnosine has its major effects. The effects of carnosine on life expectancy have been shown both in vitro (39) and in vivo (40), and the findings reported here may help to explain the shortened life expectancy in both patients with diabetic nephropathy and their relatives (37,41). Since carnosines have been reported to be generated in vivo by exercise (42), our findings provide a possible molecular basis for the previously reported beneficial effects of exercise on the incidence of diabetic nephropathy in patients with diabetes (43,44).
Although the association between CNDP1 Mannheim and protection against diabetic nephropathy was robust in the four populations tested, patients with CNDP1 Mannheim occasionally developed diabetic nephropathy. This indicates that additional modifying genes contribute to the genetic predisposition to develop diabetic nephropathy. A recent report by Bowden et al. (8) confirms the existence of four more loci, some of which may be restricted to African-American patients with diabetes. We assume that the occurrence of diabetic nephropathy is the net result of two counteracting mechanisms: protein glycation (mainly determined by glucose levels) and protective factors such as tissue carnosine content. It has been shown that in patients with type 1 and type 2 diabetes, there is a good correlation between diabetes regulation (as documented by HbA1c [A1C] levels) and the chances of developing diabetic nephropathy (45,46). It is therefore conceivable that patients with CNDP1 Mannheim may still develop diabetic nephropathy when blood glucose levels are very poorly controlled. Further clinical studies will be required to address this issue in more detail.
CNDP1 Mannheim was associated with lower serum carnosinase activity. However, we were unable to detect any meaningful serum carnosine levels; this is most likely explained by the high activity of serum carnosinase. It is unknown how polymorphisms in the CNDP1 gene relate to carnosine levels in kidney tissues. Our study did not confirm the absence of CNDP1 expression in kidneys, as suggested by Teufel et al. (13) but clearly showed CNDP1 mRNA and protein expression in the glomerulus. The increased presence of the gene product in glomeruli with diabetic nephropathy is compatible with a crucial role of this molecule in the pathogenesis of diabetic nephropathy.
We conclude that the number of leucine repeats in the leader peptide of the CNDP1 gene is associated with susceptibility for diabetic nephropathy. The findings implicate carnosine as an important protective factor in diabetes. The value of the leucine repeat as a tool to determine the risk of a patient with type 1 or type 2 diabetes for developing diabetic nephropathy has to be investigated in a prospective setting. Our study suggests that carnosine or carnosine derivates may possibly be used to design new therapeutic strategies to optimize renoprotection in diabetes.
ACKNOWLEDGMENTS
This survey was funded by the Deutsche Forschungsgemeinschaft (project no. WO 686/4-2). The collaboration with the Third Medical Faculty in Prague was funded by the international bureau of the Bundesministerium fe Bildung und Forschung, (project no. CZE 03/014). This group was also funded by the Czech Ministry of Education and Youth (MSM 0021620814). Sequencing of CNDP2 and CNDP1 was funded by the Heinrich-Vetter-Stiftung, Mannheim. The collaboration with the Rijksuniversiteit Groningen was sponsored by the Deutsche Forschungsgemeinschaft, GRK 880.
We thank Georg Hoffmann and the contributing centers for making this project feasible. We thank Ruediger Waldherr and Walter Back for providing renal specimens, Katie Wicks for genotyping, Gerard te Meerman and Ulrich Mansmann for fruitful discussions, and Barbeleis Gassel for clinical assistance.
Contributors: Recruitment and screening of records of patients was performed by H.K., M.R., M.Z., and D.H., with assistance from M.C., I.R., S.J.L.B., and P.N. Participating centers and contact persons were Fifth Medical University Clinic, University Clinic at Mannheim, Germany; Diabetes Polyclinics, Dialysis Unit, and Kidney Transplantation Unit, University Clinic at Groningen, The Netherlands, (R.O.B. Gans); Diabetologist Practice, Speyer, Germany (T. Segiet); Diabetes Polyclinic, University Clinic at Heidelberg, Germany (A. Hamann); Medical Center, Leeuwarden, The Netherlands (J. Broekroelofs); Second Medical Department, Third Medical Faculty, Charles University Prague, Czech Republic (J. Psottova); University Clinic at Teingen, Germany (T. Risler and B. Friedrich); Communal Clinic, Ludwigshafen, Germany, kidney biopsy records (R. Bergner); and Hamad Medical Corporation, Doha, Qatar. B.J., D.H., and F.V.D.W. were the lead investigators in this project and were principally responsible for the data analysis, interpretation, and preparation of this report. Together with the lead investigators, C.R.B and H.-P.H. were involved in study design and logistical matters. E.D.H and H.B. determined gene expression levels in kidneys. N.R. and J.M. performed the genetic analyses. V.P., N.R., and J.Z. were responsible for determination of carnosine levels and enzyme activities. The in vitro studies were performed by P.B., S.S., and B.A.Y., E.R., P.M., and M.A.S. provided the cell lines. C.F. provided statistical expertise.
FOOTNOTES
B.J., D.H., and P.B. contributed equally to this study.
AGE, advanced glycation end product; ROS, radical oxygen species; TGF-, transforming growth factor-
REFERENCES
Harvey JN: Trends in the prevalence of diabetic nephropathy in type 1 and type 2 diabetes. Curr Opin Nephrol Hypertens12 :317 eC322,2003
Seaquist ER, Goetz FC, Rich S, Barbosa J: Familial clustering of diabetic kidney disease: evidence of genetic susceptibility to diabetic nephropathy. N Engl J Med320 :1161 eC1165,1989
Fava S, Hattersley AT: The role of genetic susceptibility in diabetic nephropathy: evidence from family studies. Nephrol Dial Transplant17 :1543 eC1546,2002
Fujisawa T, Ikegami H, Kawaguchi Y, Hamada Y, Ueda H, Shintani M, Fukuda M, Ogihara T: Meta-analysis of association of insertion/deletion polymorphism of angiotensin I-converting enzyme gene with diabetic nephropathy and retinopathy. Diabetologia41 :47 eC53,1998
Kunz R, Bork JP, Fritsche L, Ringel J, Sharma AM: Association between the angiotensin-converting enzyme-insertion/deletion polymorphism and diabetic nephropathy: a methodologic appraisal and systematic review. J Am Soc Nephrol9 :1653 eC1663,1998
Tarnow L, Gluud C, Parving HH: Diabetic nephropathy and the insertion/deletion polymorphism of the angiotensin-converting enzyme gene. Nephrol Dial Transplant13 :1125 eC1130,1998
Vardarli I, Baier LJ, Hanson RL, Akkoyun I, Fischer C, Rohmeiss P, Basci A, Bartram CR, Van Der Woude FJ, Janssen B: Gene for susceptibility to diabetic nephropathy in type 2 diabetes maps to 18q22.3eC23. Kidney Int62 :2176 eC183,2002
Bowden DW, Colicigno CJ, Langefeld CD, Sale MM, Williams A, Anderson PJ, Rich SS, Freedman BI: A genome scan for diabetic nephropathy in African Americans. Kidney Int66 :1517 eC1526,2004
Holmes DI, Wahab NA, Mason RM: Cloning and characterization of ZNF236, a glucose-regulated Kruppel-like zinc-finger gene mapping to human chromosome 18q22eCq23. Genomics60 :105 eC109,1999
Halama N, Yard-Breedijk A, Vardarli I, Akkoyun I, Yard B, Janssen B, van der Woude FJ: The Kruppel-like zinc-finger gene ZNF236 is alternatively spliced and excluded as susceptibility gene for diabetic nephropathy. Genomics82 :406 eC411,2003
Masson E, Troncy L, Ruggiero D, Wiernsperger N, Lagarde M, Bawab SE: A-series gangliosides mediate the effects of advanced glycation end products of pericyte and mesangial cell proliferation: a common mediator for retinal and renal microangiopathy Diabetes54 :220 eC227,2005
Hipkiss AR, Preston JE, Himsworth DT, Worthington VC, Keown M, Michaelis J, Lawrence J, Mateen A, Allende L, Eagles PA, Abbott NJ: Pluripotent protective effects of carnosine, a naturally occurring dipeptide. Ann N Y Acad Sci854 :37 eC53,1998
Teufel M, Saudek V, Ledig JP, Bernhardt A, Boularand S, Carreau A, Cairns NJ, Carter C, Cowley DJ, Duverger D, Ganzhorn AJ, Guenet C, Heintzelmann B, Laucher V, Sauvage C, Smirnova T: Sequence identification and characterization of human carnosinase and a closely related non-specific dipeptidase. J Biol Chem278 :6521 eC6531,2003
Schonherr J: Analysis of products of animal origin in feeds by determination of carnosine and related dipeptides by high-performance liquid chromatography. J Agric Food Chem50 :1945 eC1950,2002
Saleem MA, O’Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing CY, Ni L, Mathieson PW, Mundel P: A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J Am Soc Nephrol13 :630 eC638,2002
Sraer JD, Delarue F, Hagege J, Feunteun J, Pinet F, Nguyen G, Rondeau E: Stable cell lines of T-SV40 immortalized human glomerular mesangial cells. Kidney Int49 :267 eC270,1996
Baelde HJ, Eikmans M, Doran PP, Lappin DW, de Heer E, Bruijn JA: Gene expression profiling in glomeruli from human kidneys with diabetic nephropathy. Am J Kidney Dis43 :636 eC650,2004
Eikmans M, Baelde HJ, de Heer E, Bruijn JA: Effect of age and biopsy site on extracellular matrix mRNA and protein levels in human kidney biopsies. Kidney Int60 :974 eC981,2001
Nakai K, Kanehisa M: A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics14 :897 eC911,1992
Von Heijne G: A new method for predicting signal sequence cleavage sites. Nucleic Acid Res14 :4683 eC4690,1985
Nerlich AG, Schleicher ED, Wiest I, Specks U, Timpl R: Immunohistochemical localization of collegen VI in diabetic glomeruli. Kidney Int45 :1648 eC1656,1994
Borsi L, Castellani P, Risso AM, Leprini A, Zardi L: Transforming growth factor-beta regulates the splicing pattern of fibronectin messenger RNA precursor. FEBS Lett261 :175 eC178,1990
Hohenadel D, van der Woude FJ: Gene expression in diabetic nephropathy. Curr Diab Rep4 :462 eC469,2004
Kagami S, Border WA, Miller DE, Noble NA: Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor- expression in rat glomerular mesangial cells. J Clin Invest93 :2431 eC2437,1994
Singh R, Alavi N, Singh AK, Leehey DJ: Role of angiotensin II in glucose-induced inhibition of mesangial matrix degradation. Diabetes48 :2066 eC2073,1999
Ziyadeh FN, Hoffman BB, Han DC, Iglesias-De La Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, Sharma K: Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal anti-transforming growth factor-beta antibody in db/db mice. Proc Natl Acad Sci97 :8015 eC8020,2000
Weigert C, Brodbeck K, Klopfer K, Haring HU, Schleicher ED: Angiotensin II induces human TGF-beta 1 promotor activation: similarity to hyperglycaemia. Diabetologia45 :890 eC898,2002
Hill C, Flyvberg A, Rasch R, Bak M, Logan A: Transforming growth factor-beta 2 antibody attenuates fibrosis in the experimental diabetic rat kidney. J Endocrinol170 :647 eC651,2001
Hipkiss AR: Carnosine, a protective, anti-aging peptide Int J Biochem Cell Biol30 :863 eC868,1998
Hou WC, Chen HJ, Lin YH: Antioxidant peptides with angiotensin converting enzyme inhibitory activity and applications for angiotensin converting enzyme purification. J Agric Food Chem51 :1706 eC1709,2003
Boldyrev A, Bulygina E, Leinsoo T, Petrushanko I, Tsubone S, Abe H: Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp Biochem Physiol137 :81 eC88,2004
Hipkiss AR, Brownson C, Bertani MF, Ruiz E, Ferro A: Reaction of carnosine with aged proteins: another protective process Ann N Y Acad Sci959 :285 eC294,2002
Brownlee M: Biochemistry and molecular cell biology of diabetic complications. Nature414 :813 eC820,2001
Brenner BM, Cooper ME, de Zeeuw D, Keane WF, Mitch WE, Parving HH, Remuzzi G, Snapinn SM, Zhang Z, Shahinfar S, the RENAAL Study Investigators: Effects of losartan on renal and cardiovascular outcomes in patients with type 2 diabetes and nephropathy. N Engl J Med345 :861 eC869,2001
Parving HH, Lehnert H, Brochner-Mortensen J, Gomis R, Andersen S, Arner P, the Irbesartan in Patients With Type 2 Diabetes and Microalbuminuria Study Group: The effect of irbesartan on the development of diabetic nephropathy in patients with type 2 diabetes. N Engl J Med345 :870 eC878,2001
Fukami K, Ueda S, Yamagishi SI, Kato S, Inagaki Y, Takeuchi M, Motomiya Y, Bucala R, Iida S, Tamaki K, Imaizumi T, Cooper ME, Okuda S: AGEs activate mesangial TGF--Smad signaling via an angiotensin II type I receptor interaction. Kidney Int66 :2137 eC2147,2004
Earle K, Walker J, Hill C, Viberti G: Familial clustering of cardiovascular disease in patients with insulin-dependent diabetes and nephropathy. N Engl J Med326 :673 eC677,1992
Adler S: Diabetic nephropathy: linking histology, cell biology, and genetics. Kidney Int66 :2095 eC2106,2004
McFarland GA, Holliday R: Retardation of the senescence of cultured human fibroblasts by carnosine. Exp Cell Res212 :167 eC175,1994
Gallant S, Semyonova M, Yuneva M: Carnosine as a potential anti-senescence drug. Biochemistry (Moscow )65 :1018 eC1021,2000
Tarnow L, Rossing P, Nielsen FS, Fagerudd JA, Poirier O, Parving HH: Cardiovascular morbidity and early mortality cluster in parents of type 1 diabetic patients with diabetic nephropathy. Diabetes Care23 :30 eC33,2000
Pan JW, Hamm JR, Rothman DL, Shulman RG: Intracellular pH in human skeletal muscle by 1H NMR. Proc Natl Acad Sci U S A85 :7836 eC7869,1988
Sjostrom L, Lindroos AK, Peltonen M, Torgerson J, Bouchard C, Carlsson B, Dahlgren S, Larsson B, Narbro K, Sjostrom CD, Sullivan M, Wedel H, the Swedish Obese Subjects Study Scientific Group: Lifestyle, diabetes, and cardiovascular risk factors 10 years after bariatric surgery. N Engl J Med351 :2683 eC2693,2004
Tuomilehto J, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Laakso M, Louheranta A, Rastas M, Salminen V, Uusitupa M, the Finnish Diabetes Prevention Study Group: Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N Engl J Med344 :1343 eC1350,2001
The Diabetes Control and Complication Trial Research Group: The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med329 :977 eC986,1993
UK Prospective Diabetes Study (UKPDS) Group: Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet352 :837 eC853,1998(Bart Janssen, Daniela Hoh)
2 Department of Nephrology, Endocrinology and Rheumatology, Fifth Medical Clinic, Mannheim, Germany
3 First Department of Pediatrics, University Hospital Heidelberg, Heidelberg, Germany
4 Second Department of Medicine and Departement of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague, Czech Republic
5 Department of Pathology, Leiden University Medical Centre, Leiden, the Netherlands
6 Department of Internal Medicine, University Medical Centre Groningen, Groningen, the Netherlands
7 Hamad Medical Corporation, Doha, Qatar
8 Service de Nephrologie A, Hopital Tenon, Institut National de la Santee et de la Recherche Medicalee, Paris, France
9 Academic Renal Unit, Southmead Hospital, Bristol, U.K
10 Department of Endocrinology and Nephrology, Third Medical Clinic, Heidelberg, Germany
ABSTRACT
The risk of diabetic nephropathy is partially genetically determined. Diabetic nephropathy is linked to a gene locus on chromosome 18q22.3-q23. We aimed to identify the causative gene on chromosome 18 and to study the mechanism by which the product of this gene could be involved in the development of diabetic nephropathy. DNA polymorphisms were determined in 135 case (diabetic nephropathy) and 107 control (diabetes without nephropathy) subjects. The effect of carnosine on the production of extracellular matrix components and transforming growth factor- (TGF-) after exposure to 5 and 25 mmol/l D-glucose was studied in cultured human podocytes and mesangial cells, respectively. A trinucleotide repeat in exon 2 of the CNDP1 gene, coding for a leucine repeat in the leader peptide of the carnosinase-1 precursor, was associated with nephropathy. The shortest allelic form (CNDP1 Mannheim) was more common in the absence of nephropathy (P = 0.0028, odds ratio 2.56 [95% CI 1.36eC4.84]) and was associated with lower serum carnosinase levels. Carnosine inhibited the increased production of fibronectin and collagen type VI in podocytes and the increased production of TGF- in mesangial cells induced by 25 mmol/l glucose. Diabetic patients with the CNDP1 Mannheim variant are less susceptible for nephropathy. Carnosine protects against the adverse effects of high glucose levels on renal cells.
Diabetic nephropathy is one of the most severe complications of type 1 and type 2 diabetes. Diabetic nephropathy has become the leading cause of end-stage renal failure in the western world. In the U.S., the number of cases of end-stage renal failure due to diabetic nephropathy continues to increase at almost 10% per year (1).
There is a large body of evidence (2,3) of familial aggregation of diabetic nephropathy, and the existence of at least one genetic susceptibility factor seems likely. The most intensively studied genetic variant is the "D/I" polymorphism in the ACE gene on chromosome 17 encoding the angiotensin converting enzyme. Meta-analyses (4eC6) have suggested a weak association between the presence of the D-allele and diabetic nephropathy.
In 2002, our group presented results of a family-based linkage study on 18 Turkish families with type 2 diabetes showing that a major susceptibility locus maps to chromosome 18q22.3-q23 (7). The locus was mapped between the markers D18S43 and D18S50 and was supported by a highly significant logarithm of odds score of 6.1. Linkage of diabetic nephropathy to 18q was confirmed by an affected sibpair analysis performed on Pima Indians and, very recently, by a large sibpair analysis of African Americans (7,8). We postulated that diabetic nephropathy might be caused by a dominant-acting mutation at this gene locus. Consequently, a recessive allele at this locus could protect carriers from the development of this complication. ZNF236 is the only gene within the 18q candidate region that had previously been considered as a candidate gene for diabetic nephropathy (9). Since no mutations in the transcript of the gene were found, ZNF236 was subsequently excluded as a trait-causing gene (10). It therefore remained unknown which gene within the 18q region is responsible for the susceptibility of some diabetic subjects to develop diabetic nephropathy. We searched for genes related to the pathophysiology of microvascular disease and focused on the inhibition of oxidative stress and advanced glycation end products (AGEs). For example, AGEs have been found in glomeruli of diabetic animals and humans, the inhibition of AGEs is beneficial in experimental diabetic nephropathy, and AGEs have been shown to cause impaired proliferation of renal mesangial cells, a major feature of diabetic nephropathy development (11). The carnosinase genes CNDP1 and CNDP2 are such genes located in 18q22.3.
The enzyme carnosinase degrades the dipeptide carnosine (-alanyl-L-histidine), while carnosine has been reported to inhibit the formation of AGE molecules (12). CNDP1 encodes the secreted serum carnosinase, whereas CNDP2 encodes tissue carnosinase, also known as cytosolic nonspecific dipeptidase (13). The genes are positioned adjacent to each other in a head-to-tail orientation. The aim of this study was to identify the causative gene on chromosome 18 and to gain insight in the mechanism by which the product of this gene could be involved in the development of diabetic nephropathy.
RESEARCH DESIGN AND METHODS
Sampling strategy for case-control study.
We screened 5,500 patient records in different centers in Germany, The Netherlands, Qatar, and the Czech Republic. A complete list of participating centers can be found in the contributors section of the ACKNOWLEDGMENTS. To identify case and control subjects, screening of all patient records of a participating center was performed, and patients not fulfilling the inclusion criteria were excluded. The detailed sampling strategy, exclusion and inclusion criteria, and details on collected data are given in the addendum available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791.
Power analysis.
Single type 2 and type 1 diabetic patients (designated groups 2 and 3, respectively) were recruited for confirmatory testing of the sequence variant selected in the first phase (an explorative search using group 1). Together, groups 2 and 3 consisted of 99 patients with diabetes and 98 patients with diabetic nephropathy. Power estimations had shown that such a sample size would be sufficient to confirm association with >80% power if the relative risk exceeds 2.5 (allele frequency 40eC50%, significance level 5%).
Sequence analysis and genotyping.
CNDP1 exons were amplified using intronic primers (MWG-Biotech, Ebersberg, Germany) and sequenced using an ABI 3100 capillary sequencer (Applied Biosystems, Darmstadt, Germany). Sequence analysis of the CNDP2 gene was performed by Synergene (Qormi, Malta). Techniques used for PCR-based genotyping of polymorphisms included restriction enzyme digest (rs2278161), fragment analysis using an ALF-Express DNA sequencer (Pharmacia-Biotech, Freiburg, Germany) (D18S58, rs10548323, rs3080862, DN31, rs10596720, D18S880, and D18S1161), TaqMan single nucleotide polymorphism genotyping using an ABI Prism 7000 (Applied Biosystems) (rs12965928 and rs2241509), denaturing high-performance liquid chromatography analysis (Transgenomic, Berlin, Germany) (rs1046407 and rs22778156), or sequence analysis (rs1559803, rs7237740, rs3764509, rs890332, rs4892247, and rs2887). Primer sequences are available on request. For D18S880, we used a standard PCR protocol with primers AGGCAGCTGTGTGAGGTAAC (forward) and GGGTGAGGAGAACATGCC (reverse). The annealing temperature was 60°C. Sequence analysis confirmed that a PCR product length of 167 corresponds to 5 CTG repeat units (five leucine codons).
Measurement of carnosine and carnosinase activity in serum.
For measurement of serum-carnosinase activity, serum samples were withdrawn between 9:00 and 10:00 A.M., cooled on ice immediately, and stored at eC80°C. A total of 150 e蘬 carnosine (1 mg/ml in 50 mmol/l Tri-HCl buffer) (Sigma Aldrich Chemie, Deisenhofen, Germany) was added to 600 e蘬 serum, divided into aliquots of 100 e蘬, and incubated at 30°C. The reaction was stopped after 5, 10, 15, 20, 30, and 40 min by adding 25 e蘬 10% 5-sulfosalicylic acid (Sigma Aldrich Chemie). After shaking, the samples were incubated at 4°C for 30 min and centrifuged at 13,000 rpm for 5 min to remove the precipitated proteins. Carnosine concentrations were assayed by fluorometic determination after derivatization with carbazole-9-carbonyl chloride. Separation was performed by liquid chromatography according to the method described by Schonherr (14).
In vitro studies
Cell culture.
Human SV 40eCtransformed mesangial cells as well as human thermosensitive SV 40eCtransformed podocytes were used to investigate the influence of L-carnosine on the increased production of extracellular matrix proteins and transforming growth factor- (TGF-)1 and -2 under hyperglycemic conditions. SV 40eCtransformed, temperature-sensitive podocytes were characterized as previously described (15). These cells proliferate at the "permissive" temperature (33°C). After transfer to the "nonpermissive" temperature (37°C), they enter growth arrest and express markers of differentiated in vivo podocytes, including nephrin, podocin, CD2AP, and synaptopodin. Human SV 40eCtransformed mesangial cells were characterized as previously described (16). All cell lines were cultivated in uncoated culture flasks in Dulbecco’s modified Eagle’s medium (PAA, Coelbe, Germany) supplemented with 10% FCS (Greiner, Frickenhausen, Germany), insulin-transferin selenium (all in concentrations of 5 ng/ml), epidermal growth factor (5 ng/ml), and penicillin/streptomycin (10 units/ml, all from Sigma, St. Louis, MO). Methods for indirect immunofluorescence, TGF-1 and -2, enzyme-linked immunosorbent assays, RNA isolation, and real-time PCR on human glomeruli, CNDP1 antibodies, and immunohistochemistry are available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791.
Computer analyses and statistical tests.
We used the PSORT II program (19) for functional analysis of 5' sequences (calculation of G. von Heijne [GvH] scores). Statistical analyses were performed with SAS V8.02 (PC version). Fisher’s exact test and 2 analyses were performed to test for association within each population group. The Mantel-Haenszel test was used to analyze data obtained from multiple populations. The Wilcoxon rank-sum test was used to compare groups of samples. P values <0.05 were regarded as significant.
RESULTS
Patient data.
A total of 5,500 patient files were screened to identify the patients included in this study. One hundred thirty-five patients with diabetic nephropathy and 107 diabetic patients without diabetic nephropathy were selected for the study. The most common cause for exclusion was microalbuminuria (30%). An equal number of patients had normoalbuminuria but a diabetes duration of <15 years. Six percent had normoalbuminuria and a sufficient diabetes duration but were on an ACE inhibitor or angiotensin II receptor 1 antagonist, which they were not willing to stop for reevaluation of albuminuria. Four percent of macroalbuminuric and diabetic dialysis patients had to be excluded because they did not have diabetic retinopathy at the onset of renal disease. Other types of diabetes (e.g., gestational diabetes or diabetes due to pancreatic disease) led to the exclusion of 10% of patients. Another 10% were unwilling to participate or unable to give informed consent. Missing data were the reason for exclusion in only 6% of patients. For exact numbers on excluded patients and decision making on inclusion and exclusion see the addendum of this article available from www.klinikum.uni-heidelberg.de/index.phpid = 6,791. If we compared the number of excluded patients per center, a similar pattern of exclusion was observed for each center. Demographic data and medication of the included patients are given in Tables 1 and 2.
Sequence analysis of coding regions.
All 12 exons of the CNDP1 gene, all 12 exons of the CNDP2 gene, and the intronic regions flanking these exons were completely sequenced in three German patients with diabetic nephropathy and in two German patients without diabetic nephropathy after 15 years of diabetes. All patients had type 2 diabetes. Several polymorphic sequence variants were detected (Table 3), but no truncating or obviously obliterating mutations were identified.
Association analysis.
We performed an explorative search for polymorphisms associated with the diabetic nephropathy trait upon the first group of patients: the "trio-group" (37 patients with type 2 diabetes and diabetic nephropathy and 8 diabetic control subjects). All polymorphisms listed in Table 3 were tested. The most significant association was found with marker D18S880, a trinucleotide repeat in CNDP1 exon 2. Since this polymorphism lies in the 5' coding part of the transcript, the number of trinucleotide repeats is directly related to the number of leucine residues in the leader peptide of the carnosinase precursor: five, six, or seven leucines. The five-leucine allele was found on 88% of chromosomes in patients without diabetic nephropathy but had an allele frequency of only 59% in the diabetic nephropathy group. In contrast to diabetic nephropathy patients, most patients without diabetic nephropathy were homozygous for this allele (P = 0.041) (odds ratio 5.54 [95% CI 0.98eC31.45]). The genotype frequencies are given in Table 4. Since the first individual found to be homozygous for the five-leucine allele came from the city of Mannheim, we designated this allele the "CNDP1 Mannheim allele."
The second patient group consisted of patients with type 2 diabetes with (n = 77) and without (n = 63) diabetic nephropathy from Germany, The Netherlands, Qatar, and the Czech Republic. In this group, we tested whether homozygosity for the CNDP1 Mannheim allele was less frequent among patients with diabetic nephropathy compared with patients without the complication. A significant difference was confirmed, with only 20 of 77 diabetic nephropathy cases being homozygous for the Mannheim allele compared with 25 of 63 cases without diabetic nephropathy (P = 0.024, single-sided Mantel-Haenszel test). The frequencies of the observed genotypes are shown in Table 4. There was no evidence of heterogeneity between the four populations.
In a third group, it was tested whether the predominance of the Mannheim allele in diabetic nephropathyeCresistant patients also applies to type 1 diabetes. Homozygosity for the Mannheim allele was found in only 4 of 21 (19%) patients with diabetic nephropathy, compared with 15 of 36 (42%) case subjects without nephropathy (P = 0.098). Combined analysis of this group with the type 2 diabetic groups mentioned above showed an odds ratio of 2.56 (95% CI 1.36eC4.84) (P = 0.0028). As shown in Table 4, the distribution of D18S880 genotypes is very similar among diabetic nephropathy patients with type 1 and type 2 diabetes; the Mantel-Haenszel test showed no evidence for heterogeneity.
Sequence comparisons on CNDP1 leader peptide.
The leader peptide at the NH2-terminal end of the serum-carnosinase precursor protein has only little homology to the consensus pattern, as published by von Heijne (20). The GvH score, used to measure homology to the consensus, is the original weight-matrix score introduced by von Heijne subtracted by 3.5. The seven-leucine allele showed a GvH score of 0.83, whereas the CNDP1 Mannheim allele showed a GvH score of eC1.76 (Fig. 1A).
Measurement of serum carnosinase activity in normal volunteers.
Serum-carnosinase activities and leucine repeat D18S880 genotypes were determined in 45 healthy volunteers. The enzyme activities (12eC46 nmol · mleC1 · heC1, mean 26.6) were plotted against the genotype (Fig. 1B). There is a clear correlation between leucine repeat number and serum-carnosinase activity (P = 0.018). The lowest activity is associated with homozygosity for the five-leucine allele. This suggests that six and seven leucine alleles can be regarded as gain-of-function mutations associated with a higher enzyme activity. Despite the immediate stabilization of serum carnosine after blood withdrawal, the measured carnosine levels were very low. In the control subjects, the carnosine concentrations ranged from 0.08 to 0.81 eol/l (mean 0.33) and are close to our detection threshold.
Confirmation of the protective role of carnosine by cell culture experiments.
Carnosine inhibited the effects of high glucose on cultured human podocytes (Fig. 2) and on cultured human mesangial cells (Fig. 3). The addition of carnosine blocked the glucose-induced increase in production of extracellular matrix components fibronectin and collagen type VI by podocytes and of TGF-2 in mesangial cells. TGF-1 production was not influenced by the addition of glucose or carnosine (data not shown).
CNDP1 expression in kidneys.
Real-time measurement of CNDP1 expression was performed on isolated glomeruli from four healthy kidneys and three diabetic nephropathy kidneys. The relative expression of CNDP1 mRNA in glomeruli from patients with diabetic nephropathy was 1.0 (range 0.4eC1.4) and 2.9 (2.7eC3.4) in control glomeruli.
Human kidney specimens from seven patients with diabetic nephropathy and five from control individuals (three pretransplantation biopsies, two from patients after undergoing tumor-related nephrectomy) were stained for CNDP1 using two different antibodies (C17E and Y18K). Both antibodies revealed a similar staining pattern for CNDP1. Representative stainings using C17E are depicted in Fig. 4. The stainings show CNDP1 expression especially in podocytes and confirm an elevated expression in all kidneys from patients with diabetic nephropathy.
DISCUSSION
This study shows that a repeat expansion in the leader peptide of the CNDP1 gene is associated with susceptibility for diabetic nephropathy in patients with type 1 and type 2 diabetes. Diabetic patients with two copies of CNDP1 Mannheim, the gene variant with the lowest number of leucine repeats in the leader peptide, are less susceptible to diabetic nephropathy. Our data confirm that susceptibility for diabetic nephropathy is a dominant trait.
We stringently excluded from this study patients with an unclear cause of renal damage, such as patients with microalbuminuria, patients in which protein excretion was only determined while they were on ACE inhibitors or ATR1 blockers, and patients without renal symptoms with a duration of diabetes <15 years. The patients in this study were white and from central and western Europe or the Middle East. These findings therefore confirm and extend earlier data obtained in Turkey, in North-American Pima Indians, and in African-American patients (7,8).
As we hypothesized, individuals with a higher number of CNDP1 leucine repeats in the leader peptide had higher serum carnosinase activity levels. Our in vitro data strengthen the plausibility of our hypothesis: the substrate of the enzyme encoded by the CNDP1 gene, carnosine, protects renal cells against the deleterious effects of high glucose levels. The carnosine concentrations used in the cell culture experiments are in the same order of magnitude as has been reported in tissues of long-lived species (12). The read-out parameters of the in vitro studies are relevant: the ED-A domains of fibronectin and collagen type VI are known to accumulate in human diabetic nephropathy (21eC23), and several in vitro and in vivo studies (24eC27) have implicated mesangial TGF- as a key mediator in diabetic renal disease. In our experiments, glucose only induced TGF-2, not -1, in cultured human mesangial cells. Hill et al. (28) have suggested that TGF-2 is closely linked to fibrogenesis in diabetic nephropathy.
Carnosine, -alanyl-L-histidine, was first described in 1900 and functions as a natural ACE inhibitor (29,30), a natural radical oxygen species (ROS) scavenger (31), an AGE breaker (32), and, thus, as a natural antiaging substance (29). The mitochondrial overproduction of ROS has been demonstrated to be fundamental in the vascular pathobiology of diabetic microvascular complications (33). In light of the properties of carnosine, it is important to note that several studies have also shown that pharmacologic inhibition of the renin-angiotensin system effectively delays disease progression in patients with diabetic nephropathy (34,35), that binding of AGEs to the receptor for AGEs is thought to mediate the release of ROS in mesangial cells in kidneys with diabetic nephropathy (36), and that nondiabetic parents of children with diabetic nephropathy have been reported to die earlier than parents of diabetic children without nephropathy (37). Because AGEs induce the production of angiotensin II in mesangial cells and carnosine may function as an ACE inhibitor (30,36), our results are compatible with the notion that the renin-angiotensin system plays a crucial role in the pathogenesis of diabetic nephropathy (rev. in 38). It remains to be determined where in the cascade of AGEeCreceptor for AGE binding, ROS generation, activation of TGF-eCSmad signaling, fibronectin synthesis, and autocrine production of angiotensin II carnosine has its major effects. The effects of carnosine on life expectancy have been shown both in vitro (39) and in vivo (40), and the findings reported here may help to explain the shortened life expectancy in both patients with diabetic nephropathy and their relatives (37,41). Since carnosines have been reported to be generated in vivo by exercise (42), our findings provide a possible molecular basis for the previously reported beneficial effects of exercise on the incidence of diabetic nephropathy in patients with diabetes (43,44).
Although the association between CNDP1 Mannheim and protection against diabetic nephropathy was robust in the four populations tested, patients with CNDP1 Mannheim occasionally developed diabetic nephropathy. This indicates that additional modifying genes contribute to the genetic predisposition to develop diabetic nephropathy. A recent report by Bowden et al. (8) confirms the existence of four more loci, some of which may be restricted to African-American patients with diabetes. We assume that the occurrence of diabetic nephropathy is the net result of two counteracting mechanisms: protein glycation (mainly determined by glucose levels) and protective factors such as tissue carnosine content. It has been shown that in patients with type 1 and type 2 diabetes, there is a good correlation between diabetes regulation (as documented by HbA1c [A1C] levels) and the chances of developing diabetic nephropathy (45,46). It is therefore conceivable that patients with CNDP1 Mannheim may still develop diabetic nephropathy when blood glucose levels are very poorly controlled. Further clinical studies will be required to address this issue in more detail.
CNDP1 Mannheim was associated with lower serum carnosinase activity. However, we were unable to detect any meaningful serum carnosine levels; this is most likely explained by the high activity of serum carnosinase. It is unknown how polymorphisms in the CNDP1 gene relate to carnosine levels in kidney tissues. Our study did not confirm the absence of CNDP1 expression in kidneys, as suggested by Teufel et al. (13) but clearly showed CNDP1 mRNA and protein expression in the glomerulus. The increased presence of the gene product in glomeruli with diabetic nephropathy is compatible with a crucial role of this molecule in the pathogenesis of diabetic nephropathy.
We conclude that the number of leucine repeats in the leader peptide of the CNDP1 gene is associated with susceptibility for diabetic nephropathy. The findings implicate carnosine as an important protective factor in diabetes. The value of the leucine repeat as a tool to determine the risk of a patient with type 1 or type 2 diabetes for developing diabetic nephropathy has to be investigated in a prospective setting. Our study suggests that carnosine or carnosine derivates may possibly be used to design new therapeutic strategies to optimize renoprotection in diabetes.
ACKNOWLEDGMENTS
This survey was funded by the Deutsche Forschungsgemeinschaft (project no. WO 686/4-2). The collaboration with the Third Medical Faculty in Prague was funded by the international bureau of the Bundesministerium fe Bildung und Forschung, (project no. CZE 03/014). This group was also funded by the Czech Ministry of Education and Youth (MSM 0021620814). Sequencing of CNDP2 and CNDP1 was funded by the Heinrich-Vetter-Stiftung, Mannheim. The collaboration with the Rijksuniversiteit Groningen was sponsored by the Deutsche Forschungsgemeinschaft, GRK 880.
We thank Georg Hoffmann and the contributing centers for making this project feasible. We thank Ruediger Waldherr and Walter Back for providing renal specimens, Katie Wicks for genotyping, Gerard te Meerman and Ulrich Mansmann for fruitful discussions, and Barbeleis Gassel for clinical assistance.
Contributors: Recruitment and screening of records of patients was performed by H.K., M.R., M.Z., and D.H., with assistance from M.C., I.R., S.J.L.B., and P.N. Participating centers and contact persons were Fifth Medical University Clinic, University Clinic at Mannheim, Germany; Diabetes Polyclinics, Dialysis Unit, and Kidney Transplantation Unit, University Clinic at Groningen, The Netherlands, (R.O.B. Gans); Diabetologist Practice, Speyer, Germany (T. Segiet); Diabetes Polyclinic, University Clinic at Heidelberg, Germany (A. Hamann); Medical Center, Leeuwarden, The Netherlands (J. Broekroelofs); Second Medical Department, Third Medical Faculty, Charles University Prague, Czech Republic (J. Psottova); University Clinic at Teingen, Germany (T. Risler and B. Friedrich); Communal Clinic, Ludwigshafen, Germany, kidney biopsy records (R. Bergner); and Hamad Medical Corporation, Doha, Qatar. B.J., D.H., and F.V.D.W. were the lead investigators in this project and were principally responsible for the data analysis, interpretation, and preparation of this report. Together with the lead investigators, C.R.B and H.-P.H. were involved in study design and logistical matters. E.D.H and H.B. determined gene expression levels in kidneys. N.R. and J.M. performed the genetic analyses. V.P., N.R., and J.Z. were responsible for determination of carnosine levels and enzyme activities. The in vitro studies were performed by P.B., S.S., and B.A.Y., E.R., P.M., and M.A.S. provided the cell lines. C.F. provided statistical expertise.
FOOTNOTES
B.J., D.H., and P.B. contributed equally to this study.
AGE, advanced glycation end product; ROS, radical oxygen species; TGF-, transforming growth factor-
REFERENCES
Harvey JN: Trends in the prevalence of diabetic nephropathy in type 1 and type 2 diabetes. Curr Opin Nephrol Hypertens12 :317 eC322,2003
Seaquist ER, Goetz FC, Rich S, Barbosa J: Familial clustering of diabetic kidney disease: evidence of genetic susceptibility to diabetic nephropathy. N Engl J Med320 :1161 eC1165,1989
Fava S, Hattersley AT: The role of genetic susceptibility in diabetic nephropathy: evidence from family studies. Nephrol Dial Transplant17 :1543 eC1546,2002
Fujisawa T, Ikegami H, Kawaguchi Y, Hamada Y, Ueda H, Shintani M, Fukuda M, Ogihara T: Meta-analysis of association of insertion/deletion polymorphism of angiotensin I-converting enzyme gene with diabetic nephropathy and retinopathy. Diabetologia41 :47 eC53,1998
Kunz R, Bork JP, Fritsche L, Ringel J, Sharma AM: Association between the angiotensin-converting enzyme-insertion/deletion polymorphism and diabetic nephropathy: a methodologic appraisal and systematic review. J Am Soc Nephrol9 :1653 eC1663,1998
Tarnow L, Gluud C, Parving HH: Diabetic nephropathy and the insertion/deletion polymorphism of the angiotensin-converting enzyme gene. Nephrol Dial Transplant13 :1125 eC1130,1998
Vardarli I, Baier LJ, Hanson RL, Akkoyun I, Fischer C, Rohmeiss P, Basci A, Bartram CR, Van Der Woude FJ, Janssen B: Gene for susceptibility to diabetic nephropathy in type 2 diabetes maps to 18q22.3eC23. Kidney Int62 :2176 eC183,2002
Bowden DW, Colicigno CJ, Langefeld CD, Sale MM, Williams A, Anderson PJ, Rich SS, Freedman BI: A genome scan for diabetic nephropathy in African Americans. Kidney Int66 :1517 eC1526,2004
Holmes DI, Wahab NA, Mason RM: Cloning and characterization of ZNF236, a glucose-regulated Kruppel-like zinc-finger gene mapping to human chromosome 18q22eCq23. Genomics60 :105 eC109,1999
Halama N, Yard-Breedijk A, Vardarli I, Akkoyun I, Yard B, Janssen B, van der Woude FJ: The Kruppel-like zinc-finger gene ZNF236 is alternatively spliced and excluded as susceptibility gene for diabetic nephropathy. Genomics82 :406 eC411,2003
Masson E, Troncy L, Ruggiero D, Wiernsperger N, Lagarde M, Bawab SE: A-series gangliosides mediate the effects of advanced glycation end products of pericyte and mesangial cell proliferation: a common mediator for retinal and renal microangiopathy Diabetes54 :220 eC227,2005
Hipkiss AR, Preston JE, Himsworth DT, Worthington VC, Keown M, Michaelis J, Lawrence J, Mateen A, Allende L, Eagles PA, Abbott NJ: Pluripotent protective effects of carnosine, a naturally occurring dipeptide. Ann N Y Acad Sci854 :37 eC53,1998
Teufel M, Saudek V, Ledig JP, Bernhardt A, Boularand S, Carreau A, Cairns NJ, Carter C, Cowley DJ, Duverger D, Ganzhorn AJ, Guenet C, Heintzelmann B, Laucher V, Sauvage C, Smirnova T: Sequence identification and characterization of human carnosinase and a closely related non-specific dipeptidase. J Biol Chem278 :6521 eC6531,2003
Schonherr J: Analysis of products of animal origin in feeds by determination of carnosine and related dipeptides by high-performance liquid chromatography. J Agric Food Chem50 :1945 eC1950,2002
Saleem MA, O’Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing CY, Ni L, Mathieson PW, Mundel P: A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J Am Soc Nephrol13 :630 eC638,2002
Sraer JD, Delarue F, Hagege J, Feunteun J, Pinet F, Nguyen G, Rondeau E: Stable cell lines of T-SV40 immortalized human glomerular mesangial cells. Kidney Int49 :267 eC270,1996
Baelde HJ, Eikmans M, Doran PP, Lappin DW, de Heer E, Bruijn JA: Gene expression profiling in glomeruli from human kidneys with diabetic nephropathy. Am J Kidney Dis43 :636 eC650,2004
Eikmans M, Baelde HJ, de Heer E, Bruijn JA: Effect of age and biopsy site on extracellular matrix mRNA and protein levels in human kidney biopsies. Kidney Int60 :974 eC981,2001
Nakai K, Kanehisa M: A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics14 :897 eC911,1992
Von Heijne G: A new method for predicting signal sequence cleavage sites. Nucleic Acid Res14 :4683 eC4690,1985
Nerlich AG, Schleicher ED, Wiest I, Specks U, Timpl R: Immunohistochemical localization of collegen VI in diabetic glomeruli. Kidney Int45 :1648 eC1656,1994
Borsi L, Castellani P, Risso AM, Leprini A, Zardi L: Transforming growth factor-beta regulates the splicing pattern of fibronectin messenger RNA precursor. FEBS Lett261 :175 eC178,1990
Hohenadel D, van der Woude FJ: Gene expression in diabetic nephropathy. Curr Diab Rep4 :462 eC469,2004
Kagami S, Border WA, Miller DE, Noble NA: Angiotensin II stimulates extracellular matrix protein synthesis through induction of transforming growth factor- expression in rat glomerular mesangial cells. J Clin Invest93 :2431 eC2437,1994
Singh R, Alavi N, Singh AK, Leehey DJ: Role of angiotensin II in glucose-induced inhibition of mesangial matrix degradation. Diabetes48 :2066 eC2073,1999
Ziyadeh FN, Hoffman BB, Han DC, Iglesias-De La Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, Sharma K: Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal anti-transforming growth factor-beta antibody in db/db mice. Proc Natl Acad Sci97 :8015 eC8020,2000
Weigert C, Brodbeck K, Klopfer K, Haring HU, Schleicher ED: Angiotensin II induces human TGF-beta 1 promotor activation: similarity to hyperglycaemia. Diabetologia45 :890 eC898,2002
Hill C, Flyvberg A, Rasch R, Bak M, Logan A: Transforming growth factor-beta 2 antibody attenuates fibrosis in the experimental diabetic rat kidney. J Endocrinol170 :647 eC651,2001
Hipkiss AR: Carnosine, a protective, anti-aging peptide Int J Biochem Cell Biol30 :863 eC868,1998
Hou WC, Chen HJ, Lin YH: Antioxidant peptides with angiotensin converting enzyme inhibitory activity and applications for angiotensin converting enzyme purification. J Agric Food Chem51 :1706 eC1709,2003
Boldyrev A, Bulygina E, Leinsoo T, Petrushanko I, Tsubone S, Abe H: Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp Biochem Physiol137 :81 eC88,2004
Hipkiss AR, Brownson C, Bertani MF, Ruiz E, Ferro A: Reaction of carnosine with aged proteins: another protective process Ann N Y Acad Sci959 :285 eC294,2002
Brownlee M: Biochemistry and molecular cell biology of diabetic complications. Nature414 :813 eC820,2001
Brenner BM, Cooper ME, de Zeeuw D, Keane WF, Mitch WE, Parving HH, Remuzzi G, Snapinn SM, Zhang Z, Shahinfar S, the RENAAL Study Investigators: Effects of losartan on renal and cardiovascular outcomes in patients with type 2 diabetes and nephropathy. N Engl J Med345 :861 eC869,2001
Parving HH, Lehnert H, Brochner-Mortensen J, Gomis R, Andersen S, Arner P, the Irbesartan in Patients With Type 2 Diabetes and Microalbuminuria Study Group: The effect of irbesartan on the development of diabetic nephropathy in patients with type 2 diabetes. N Engl J Med345 :870 eC878,2001
Fukami K, Ueda S, Yamagishi SI, Kato S, Inagaki Y, Takeuchi M, Motomiya Y, Bucala R, Iida S, Tamaki K, Imaizumi T, Cooper ME, Okuda S: AGEs activate mesangial TGF--Smad signaling via an angiotensin II type I receptor interaction. Kidney Int66 :2137 eC2147,2004
Earle K, Walker J, Hill C, Viberti G: Familial clustering of cardiovascular disease in patients with insulin-dependent diabetes and nephropathy. N Engl J Med326 :673 eC677,1992
Adler S: Diabetic nephropathy: linking histology, cell biology, and genetics. Kidney Int66 :2095 eC2106,2004
McFarland GA, Holliday R: Retardation of the senescence of cultured human fibroblasts by carnosine. Exp Cell Res212 :167 eC175,1994
Gallant S, Semyonova M, Yuneva M: Carnosine as a potential anti-senescence drug. Biochemistry (Moscow )65 :1018 eC1021,2000
Tarnow L, Rossing P, Nielsen FS, Fagerudd JA, Poirier O, Parving HH: Cardiovascular morbidity and early mortality cluster in parents of type 1 diabetic patients with diabetic nephropathy. Diabetes Care23 :30 eC33,2000
Pan JW, Hamm JR, Rothman DL, Shulman RG: Intracellular pH in human skeletal muscle by 1H NMR. Proc Natl Acad Sci U S A85 :7836 eC7869,1988
Sjostrom L, Lindroos AK, Peltonen M, Torgerson J, Bouchard C, Carlsson B, Dahlgren S, Larsson B, Narbro K, Sjostrom CD, Sullivan M, Wedel H, the Swedish Obese Subjects Study Scientific Group: Lifestyle, diabetes, and cardiovascular risk factors 10 years after bariatric surgery. N Engl J Med351 :2683 eC2693,2004
Tuomilehto J, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Laakso M, Louheranta A, Rastas M, Salminen V, Uusitupa M, the Finnish Diabetes Prevention Study Group: Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N Engl J Med344 :1343 eC1350,2001
The Diabetes Control and Complication Trial Research Group: The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med329 :977 eC986,1993
UK Prospective Diabetes Study (UKPDS) Group: Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet352 :837 eC853,1998(Bart Janssen, Daniela Hoh)