Two 1-Adrenergic Receptor Subtypes Regulating the Vasopressor Response Have Differential Roles in Blood Pressure Regulation
Department of Molecular, Cell Pharmacology, National Research Institute for Child Health and Development, Tokyo, Japan (C.H., A.T., T.Ko., H.S., S.O.)
Department of Pharmacology, Tokyo University of Pharmacy and Life Science, Horinouchi, Hachioji, Tokyo, Japan (Y.N., R.O., T.T., S.F., S.T.)
Department of Urology, Faculty of Medicine, University of Tokyo, Tokyo, Japan (C.H., T.Ki.)
Institut de Pharmacologie et Toxicologie, Universit de Lausanne, Lausanne, Switzerland (S.C.)
Department of Genomic Drug Discovery Science, Graduate School of Pharmaceutical Sciences, Kyoto University Faculty of Pharmaceutical Sciences, Kyoto University, Kyoto, Japan (G.T.)
Abstract
To study the functional role of individual 1-adrenergic (AR) subtypes in blood pressure (BP) regulation, we used mice lacking the 1B-AR and/or 1D-AR with the same genetic background and further studied their hemodynamic and vasoconstrictive responses. Both the 1D-AR knockout and 1B-/1D-AR double knockout mice, but not the 1B-AR knockout mice, had significantly (p < 0.05) lower levels of basal systolic and mean arterial BP than wild-type mice in nonanesthetized condition, and they showed no significant change in heart rate or in cardiac function, as assessed by echocardiogram. All mutants showed a significantly (p < 0.05) reduced catecholamine-induced pressor and vasoconstriction responses. It is noteworthy that the infusion of norepinephrine did not elicit any pressor response at all in 1B-/1D-AR double knockout mice. In an attempt to further examine 1-AR subtype, which is involved in the genesis or maintenance of hypertension, BP after salt loading was monitored by tail-cuff readings and confirmed at the endpoint by direct intra-arterial recording. After salt loading, 1B-AR knockout mice developed a comparable level of hypertension to wild-type mice, whereas mice lacking 1D-AR had significantly (p < 0.05) attenuated BP and lower levels of circulating catecholamines. Our data indicated that 1B- and 1D-AR subtypes participate cooperatively in BP regulation; however, the deletion of the functional 1D-AR, not 1B-AR, leads to an antihypertensive effect. The study shows differential contributions of 1B- and 1D-ARs in BP regulation.
Catecholamines released from sympathetic nerve terminals cause vascular smooth muscle contraction primarily by activating 1-adrenergic receptors (1-ARs) in arteries (Hoffman, 2001). Thus, blockade of 1-AR leads to a fall in peripheral vascular resistance. Because of their consistent effect in lowering systemic blood pressure (BP), 1-AR blockers have been widely used as an antihypertensive drug. However, a large clinical trial unexpectedly disclosed that doxazosin, a nonselective 1-AR antagonist, was associated with an increased incidence of heart failure (ALLHAT Collaborative Research Group, 2000). This raised a serious concern about the long-term use of 1-AR antagonists in the treatment of hypertension (HT) (ALLHAT Collaborative Research Group, 2000). On the other hand, clinical efficacy of a subtypeselective inhibition of 1-AR has not been fully determined.
The three known 1-AR subtypes (1A-, 1B-, and 1D-AR) participate in the constellation of 1-adrenergic activities in the cardiovascular system (Hieble et al., 1995). All of these receptors are coupled to Ca2+ signaling, leading to smooth muscle contraction (Esbenshade et al., 1995; Hieble et al., 1995). Elucidation of the physiological and pathophysiological roles of the specific 1-AR subtype has been hampered, because the 1-AR subtypes are coexpressed in the same arterial smooth muscles with different ratios (Michelotti et al., 2000; Piascik and Perez, 2001) and sufficiently subtype-selective agonists and antagonists have not been available (Esbenshade et al., 1995; Guimaraes and Moura, 2001; Piascik and Perez, 2001). In addition, recent biochemical and pharmacological studies confirmed the potential role of dimerization of distinct 1-AR subtypes in controlling their expression and pharmacological properties (Stanasila et al., 2003; Uberti et al., 2003). Therefore, complex interactions of subtypes could be expected when subtypes are coexpressed in a same smooth muscle cell.
In this study, we used three mice groups specifically lacking the 1B-AR and/or 1D-AR subtypes (1BeC/eC, 1DeC/eC, and 1BDeC/eC) to examine the individual and cooperative roles of these receptor subtypes in BP regulation, both under basal conditions and in the development of salt-induced experimental HT. In addition, responsiveness to intravenous infusion of catecholamines was compared by direct measurement of arterial pressure. Our data showed that 1B- and 1D-ARs play distinctive contributions to the resting and agonist-stimulated BP regulations, particularly to the progression of hypertensive state.
Materials and Methods
Generation of mice lacking both the 1B-AR and 1D-AR subtypes. 1BeC/eC and 1DeC/eC mice have been generated and characterized previously (Cavalli et al., 1997; Tanoue et al., 2002b). Disruption of the 1B-or 1D-AR gene was achieved using a positive-negative selection strategy to effect homologous recombination in embryonic stem cells, using the targeting construct. The strain background of both 1BeC/eC and 1DeC/eC mice was a mixture of 129Sv and C57Bl6/J. Double knockout 1BDeC/eC mice were generated by mixture of homozygous 1BeC/eC and 1DeC/eC mice. The resulting F1 generation of compound heterozygotes was subsequently intercrossed to generate F2 mice with all possible combinations of 1B- and 1D-AR gene disruptions. Mice were genotyped for both 1B- and 1D-AR disruptions by Southern blotting or PCR of mouse tail biopsies (Cavalli et al., 1997; Tanoue et al., 2002b). According to Mendel's law, 1/16 of progeny were predicted to be homozygous-deficient for 1B- and 1D-AR, and 1/16 of progeny were predicted to be wild type (WT) for both 1B- and 1D-AR. The F2 double knockout 1BDeC/eC mice were bred to produce double knockout mice used in our experiments. The wild-type F2 mice were bred to produce WT control mice. Thus, the overall strain contributions in the WT, 1BeC/eC, 1DeC/eC and 1BDeC/eC mice were equivalent. Animals were housed in micro-isolator cages in a pathogen-free barrier facility. All experimentation was performed under approved Institutional Guidelines. All mice used in this study were 7 to 9 weeks old male ones.
RT-PCR Analysis. Total RNA from different mouse tissues was prepared using Isogen (Nippon Gene Co. Ltd., Tokyo, Japan). Total RNA of 5 e was treated with RNase-free DNase (TaKaRa Bio Co., Tokyo, Japan) and reverse-transcribed using random hexamers (Tanoue et al., 1990). One-tenth of each cDNA sample was amplified by PCR with a receptor-specific primer set and a primer set specific for GAPDH (Sabath et al., 1990). Each sample contained the upstream and downstream primers (10 pmol of each), 0.25 mM of each dNTP, 50 mM KCl, 10 mM Tris-HCl, pH 8.6, 1.5 mM MgCl2, and 2.5 U of TaqDNA polymerase (TaKaRa Bio Co.). Thermal cycling was performed for 1 min at 94°C, 1 min at 56°C, and 2 min at 72°C for 27 cycles. The upstream and downstream primers (5'3') were AGGCTGCTCAAGTTTTCTCG and CAGATTGGTCCTTTGGCACT for 1A-AR (275 bp), GGGAGAGTTGAAAGATGCCA and TTGGTACTGCTGAGGGTGTC for 1B-AR (752 bp), and CGCTGTGGTGGGAACCGGCAG and ACAGCTGCACTCAGTAGCAGGTCA for 1D-AR (282 bp). The upstream primer for the 1A-AR or the 1B-AR gene was located within the first exon, and the downstream primer for the 1A-AR or the 1B-AR gene was located within the second exon. The primers for the 1D-AR gene were located within the first exon, and the forward primer was within the region replaced with the Neo in the mutant allele. The primers were derived from the murine 1A-AR, 1B-AR, and 1D-AR sequences (Alonso-Llamazares et al., 1995). The GAPDH primers (5'3') were GGTCATCATCTCCGCCCCTTC upstream and CCACCACCCTGTTGCTGTAG downstream (662 bp). Control PCR reactions also were performed on noneCreverse-transcribed RNA to exclude any contamination by genomic DNA. The amplified DNAs were analyzed on a 1.5% agarose gel with 100-bp DNA marker (New England Biolabs, Beverly, MA). The specificity of the amplified DNA fragments was determined by Southern blot analysis using receptor-specific 32P-labeled probes (Alonso-Llamazares et al., 1995).
Radioligand Ligand Binding Study. Radioligand binding studies were performed on membrane preparations of mouse native tissues (Shibata et al., 1995). In brief, whole brain, heart, liver, kidney, and aorta were dissected from mice, placed in lysis buffer A (250 mM sucrose, 5 mM Tris-HCl, and 1 mM MgCl2, pH 7.4), and homogenized with a Polytron homogenizer (Kinematica, Basel, Switzerland) at 4°C, at speed 7 for 10 s. The homogenate was then centrifuged at 1000g at 4°C for 10 min to remove the nuclei. The supernatant fraction was centrifuged at 35,000g for 20 min at 4°C. The resulting pellet was re-suspended in binding buffer B (50 mM Tris-HCl, 10 mM MgCl2, and 10 mM EGTA, pH 7.4) and was frozen at eC80°C until assay. Protein concentration was measured using the bicinchoninic acid protein assay kit (Pierce Chemical, Rockford, IL). Radioligand binding studies were performed using 125I-(2--(4-hydroxyphenyl)-ethylaminomethyl)-tetralone (125I-HEAT; 2200 Ci/mmol; PerkinElmer Life and Analytical Sciences, Boston, MA) or [7-methoxy-3H]prazosin ([3H]prazosin; 83.8 Ci/mmol; PerkinElmer Life and Analytical Sciences). In brief, 20 to 100 e of membrane protein from brain, aorta, and heart were incubated with 125I-HEAT, and membranes from liver and kidney were incubated with [3H]prazosin in a final volume of 250 e of binding buffer B in the presence or absence of competing drugs for 60 min at 25°C. The incubation was terminated by addition of the ice-cold buffer B and immediate filtration through Whatman GF/C glass fiber filters with a Brandel cell harvester (model-30; Brandel Inc., Gaithersburg, MD). Each filter was collected, and the radioactivity was measured. Binding assays were always performed in duplicate. For competition curve analysis, each assay contained about 100 pM 125I-HEAT or [3H]prazosin. Nonspecific binding was defined as binding displaced by 10 e phentolamine.
Measurement of BP and HR. Systolic BP (SBP) and heart rate (HR) were measured in conscious mice with a computerized tail-cuff system (BA-98A system; Softron Co., Tokyo, Japan) that determines SBP using a photoelectric sensor (Tanoue et al., 2002b). Before the study was initiated, at least 3 days of training sessions were provided for the mice to become accustomed to the tail-cuff procedure. Sessions of recorded measurements were then made form 1:00 to 5:00 PM daily on three consecutive days. Each session included more than 10 tail-cuff measurements. Mean arterial pressure (MAP) and HR were also measured in nonanesthetized mice by an intra-arterial catheter (Tanoue et al., 2002b). After cervical incision on mice anesthetized with sodium pentobarbital (40 mg/kg i.p.), a stretched intramedic PE-10 polyethylene catheter (Clay Adams, Parsippany, NJ) was inserted into the right carotid artery. The catheter was tunneled through the neck and then placed in a subcutaneous pouch in the back. After a minimum of 24-h recovery, mice were placed in Plexiglas tubes to partially restrict their movements, and the saline-filled catheter was removed from the pouch and connected to a pressure transducer (DX-360; Nihonkohden, Tokyo, Japan), and MAP was recorded on a thermal pen recorder (RTA-1200; Nihonkohden). Measurement of HR was triggered from changes in MAP (AT-601G; Nihonkohden). To examine pressor responses in nonanesthetized mice, drugs in 30 e of injection volume (1 e/g of mouse body weight) were administered through catheter inserted into the right femoral vein as a bolus at 15- to 20-min intervals after ensuring MAP and HR had returned to baseline levels.
The effect of 1-antagonists on the norepinephrine-induced pressor response was examined in each mouse group. After propranolol (1 mg/kg) treatment, either bunazosin hydrochloride (10 e/kg i.v.; Eisai Co. Ltd., Tokyo, Japan) or BMY7378 (100 e/kg i.v.; Sigma/RBI, Natick, MA) was administered 10 min before the continuous infusion of norepinephrine (1 e/kg/min i.v. for 5 min) using a micro-syringe pump (CFV-2100; Nihonkohden).
Measurement of Blood Chemistries. After 1 h of stable anesthesia (80 mg/kg pentobarbital, intraperitoneally), blood was drawn slowly from the right carotid arterial line to measure total plasma catecholamine levels (epinephrine, norepinephrine, and dopamine), angiotensin I and II levels, creatinine levels, blood cell counts, hematocrit and serum electrolytes. Plasma catecholamine levels were determined by high pressure liquid chromatography using commercially available reagents (Tosho Co., Tokyo, Japan). Plasma angiotensin I and II were measured with a radioimmunoassay kit (PerkinElmer Life and Analytical Sciences) and plasma creatinine by a colorimetric kit (Sigma-Aldrich, St. Louis, MO).
Measurement of Aortic Contraction. The thoracic aorta was prepared for aortic contractile responses to drugs as described previously (Tanoue et al., 2002b). In brief, the excised thoracic aorta was cleaned and cut into 1 mm segments. These segments were suspended in isolated tissue baths filled with 10 ml Krebs-Henseleit bicarbonate buffer containing timolol (3 e), continuously bubbled with a gas mixture of 5% CO2 and 95% O2 at 37°C. One end of the aortic segment was connected to a tissue holder and the other to an isometric force transducer. Aortic segments were equilibrated for 60 min under a resting tension of 0.5 g, and the buffer was replaced every 15 min. In a preliminary experiment, the length of the smooth muscle was increased stepwise during the equilibration period to adjust passive wall tension to 0.5 g; this resting tension was found to be optimal for KCl (40 mM)-induced aortic contraction of mice weighing 20 to 23 g. Care was taken to avoid endothelial damage; functional integrity of the endothelium was assessed using acetylcholine (10 e). Only intact segments were used for further analysis.
Pressor Response in Perfused Mesenteric Arterial Beds. The mesenteric arterial beds were prepared to measure the perfusion pressure (Nasa et al., 1998). The superior mesenteric artery of diethyl ether-anesthetized mice was dissected and a stainless steel cannula (27-gauge syringe) was inserted. The preparations were perfused with Krebs-Henseleit solution equilibrated with a mixture of 95% O2 and 5% CO2 (PO2 >600 mm Hg). The entire ileum was dissected longitudinally at the opposite site of mesenteric vasculature. The preparation was placed in a chamber with a warm water jacket to maintain at 37°C. The perfusion flow rate was maintained at 1.0 ml/min using a peristaltic pump. Perfusion pressure was measured through a branch of the perfusion cannula by means of a pressure transducer (TP-400T; Nihonkohden) connected to a carrier amplifier (AP-621G; Nihonkohden) and recorded on a thermal pen recorder (WT-645G; Nihonkohden). The preparations were equilibrated for 30 min before administration of phenylephrine.
Histological Analysis of Heart and Thoracic Aorta. Heart-to-body weight ratios were calculated as milligrams per gram. For histological analysis, heart and thoracic aorta were fixed with perfusion of phosphate-buffered saline plus 10% formalin. Several sections of hearts and aorta were obtained for gross morphological analysis and then paraffin embedded for thin sectioning followed by hematoxylin and eosin staining.
Echocardiography. Quantitative echocardiographic measurements were performed on lightly anesthetized, spontaneously breathing mice (Tanoue et al., 2002b). Mice were anesthetized (40 mg/kg pentobarbital i.p.), the chest area was shaved, and ultrasonic gel was applied. The measurements with the SONOS-5500 system (Philips Medical Systems, Andover, MA) used a dynamically focused symmetrical annular array transducer (12.5 MHz) for two-dimensional, M-mode, and Doppler imaging. The parasternal long and short axes and four chamber views were visualized. For quantitative analysis, measurements were performed in three to five consecutive cardiac cycles. Cardiac parameters determined include interventricular septal thickness, posterior wall thickness, left ventricular internal dimension in diastole (LVIDd) and in systole (LVIDs), and HR. LVIDd and LVIDs were normalized to body weight, and percentage of fractional shortening (%FS) was calculated as 100 x [(LVIDdeCLVIDs)/LVIDd]. Cardiac output was calculated from Doppler echocardiography using the equation [ x (Ao)2 x VTI x HR]/4, where Ao was the diameter of the aortic artery, VTI was the Doppler velocity time integral in left ventricular outflow, and HR was determined from the simultaneous monitoring of electrocardiogram.
Nephrectomy and Salt-Induced HT. Mice, weighing 18 to 23 g, were subjected to two steps of nephrectomy protocol (Johns et al., 1996). In brief, both poles of the left kidney were excised under anesthesia with intraperitoneal sodium pentobarbital (50 mg/kg), leaving a small amount of residual renal tissue around the hilum and preserving the ureter and hilar vessels. The excised renal tissues were weighed, and the ratios of those organs to the body weights were calculated. After a 7-day recovery period, the right kidney was removed, leaving 25% of the total renal mass. Twenty-four hours after the second operation, the animals were maintained with 1% saline as drinking water for 35 days. SBP and HR were monitored by tail-cuff system as described above. At the endpoint, SBP and HR were recorded for three consecutive days and averaged. HT was defined as follows: tail-cuff SBP that reached 150 mmHg, or an increase of >40 mmHg above the baseline.
Data Analysis. All values are expressed as means ± S.E.M. Differences among each group of mice were assessed by ANOVA with subsequent Bonferroni's post hoc test for multiple comparisons. Data from the radioligand binding study were analyzed using the iterative nonlinear regression program LIGAND (Munson and Rodbard, 1980). The presence of one, two or three different binding sites was assessed using the F-test in the program. Cumulative survival curves were constructed by the Kaplan-Meier method (Kaplan and Meier, 1958), and differences between the curves were tested for significance using the log-rank statistic. Statistical significance was established at a value of p < 0.05. Apparent pD2 value, agonist dose or concentration that gives half-maximal response, was calculated from dose-response or concentration-response curves constructed from experiments. Difference among the concentration-response curves was evaluated by two-way ANOVA, if applicable.
Results
The 1BeC/eC and 1DeC/eC single knockout mice, which have the same genetic background, were crossed to produce the 1BDeC/eC double knockout mice. The 1BDeC/eC mice were viable at the expected Mendelian ratios from heterozygote intercrosses. They developed normally and showed no gross abnormalities. Analysis of venous blood samples from these mutant mice showed no significant difference in the following parameters: plasma creatinine, plasma catecholamine, epinephrine, norepinephrine, angiotensin I and II levels (baseline values in Table 1), blood cell counts, hematocrit, and serum electrolytes (data not shown).
Expression of 1-AR in 1BDeC/eC Mice. We confirmed the lack of 1B-AR and 1D-AR expression in the mutant mice by RT-PCR and by radioligand binding studies. RT-PCR analysis showed that the 1BDeC/eC mice expressed neither 1B-AR nor 1D-AR mRNA in any tissue examined (brain, heart, aorta, kidney, and liver; data not shown) and had no apparent compensatory up-regulation of 1A-AR mRNA. Corresponding well with the RT-PCR results, radioligand binding studies showed a decreased 1-AR binding capacity in the brain, heart, and kidney of knockout mice (Table 2). 1B-AR and 1D-AR are predominant 1-AR in the liver and aorta, respectively (Cavalli et al., 1997; Tanoue et al., 2002b), and 1-AR ligand-binding capacities in the liver and aorta of 1BDeC/eC mice were markedly diminished (Table 2), indicating that no significant compensatory increase of 1-AR binding site in these mice. In accordance with data of saturation binding experiments, competition binding experiments using the 1A-AR-selective antagonist KMD-3213 (Shibata et al., 1995) showed that only high-affinity binding site for KMD-3213 was detected in the brain of 1BDeC/eC mice (KH = 0.26 nM), whereas two sites were detected in WT, 1BeC/eC, and 1DeC/eC mice (Table 3).
Specific binding was measured with 125I-HEAT for the brain, aorta, and heart, and with [3H]prazosin for the liver and kidney as described under Materials and Methods. Each value is the means ± S.E.M. of four to six different experiments.
Inhibition of specific 125I-HEAT binding by KMD-3213 was determined in membrane preparations from the mouse brain. The best two-site fit was determined by nonlinear regression analysis of the averaged curve, and high- and low-affinity sites for KMD-3213.
Hemodynamic Parameters. We measured systemic BP in the series of mutant mice to delineate consequences of deleting two 1-AR subtypes. When resting SBP of conscious mice was monitored by tail-cuff, the mean SBP values were significantly low in two mouse groups deleted with 1D-AR gene, 1DeC/eC, and 1BDeC/eC, compared with those of WT and 1BeC/eC mice (99 ± 2 mm Hg for WT, n = 10; 99 ± 3 mm Hg for 1BeC/eC, n = 9; 93 ± 2mm Hg for 1DeC/eC, n = 9; 92 ± 2mm Hg for 1BDeC/eC, n = 9, p < 0.05). These differences were also confirmed by direct pressure measurement by intra-arterial catheter (Table 4). Averaged HR during the BP monitoring was a similar level in all mice groups in tail-cuff recording (542 ± 16 bpm for WT, n = 10; 520 ± 20 bpm for 1BDeC/eC mice, n = 9; 533 ± 17 bpm for 1DeC/eC mice, n = 9; and 516 ± 28 bpm for 1BDeC/eC mice, n = 9) and in direct intra-arterial recording (Table 4).
MAP and HR were measured in nonanesthetized mice as described under Materials and Methods. Values are the mean ± S.E.M. of nine to 18 mice.
We next examined the pressor responses to several vasoactive agents in nonanesthetized mice. As 1-AR agonists, we administered phenylephrine (0.1eC300 e/kg), norepinephrine (0.1eC10.0 e/kg), or the 1A-selective agonist A61603 (0.01eC 3.0 e/kg). The analysis showed a significant difference in the pressor response curves to phenylephrine between WT and 1BDeC/eC mice (Fig. 1A). The pD2 values for phenylephrine in WT, 1BeC/eC, 1DeC/eC and 1BDeC/eC mice were 9 ± 2, 10 ± 2, 12 ± 1, and 19 ± 3 e/kg (n = 15eC22), respectively. The responses to norepinephrine of each mutant mouse were also significantly less than that of WT (Fig. 1B). The maximal plateau level of pressor responses to norepinephrine could not be monitored, because high doses of norepinephrine frequently caused circulatory collapse because of its cardiac toxicity. Unlike phenylephrine or norepinephrine, WT and 1BDeC/eC mice showed similar pressor response to A61603 infusion (Fig. 1C). None of the mutant mice exhibited a significant alteration in pressor responses to nonadrenergic vasoactive stimuli, such as angiotensin II or vasopressin. Increases in BP by intravenous administration of angiotensin II (100 ng/kg) were 31.4 ± 2.8, 33.4 ± 2.4, 30.8 ± 3.6, and 33.4 ± 2.4 mm Hg in WT, 1BeC/eC, 1DeC/eC, and 1BDeC/eC (n = 6eC11), respectively. Vasopressin (100 ng/kg)-induced BP increases were 12 ± 0.6, 19.5 ± 3.2, 23.8 ± 8.7, and 22.4 mm Hg in WT, 1BeC/eC, 1DeC/eC, and 1BDeC/eC (n = 4eC9), respectively.
We further assessed the contribution of each subtype to the 1-AR-mediated pressor response. Continuous infusion of norepinephrine (1 e/kg/min, for 5 min) promptly induced a significant increase in BP (23 ± 2 mm Hg, n = 16), which lasted during the administration of norepinephrine in WT mice (Fig. 1D). This BP increase was suppressed partly by 100 e/kg BMY7378, an 1D-selective antagonist (Goetz et al., 1995), and almost lost by 10 e/kg bunazosin, a nonselective 1-AR antagonist (Takeo et al., 1988). In 1BDeC/eC mice, the norepinephrine-induced increase in MAP was similar to that of WT mice (21 ± 2 mm Hg, n = 16) and was inhibited by pretreatment with either BMY7378 or bunazosin (Fig. 1E). In 1DeC/eC mice, the norepinephrine-induced MAP increase was significantly less than that of WT mice (19 ± 1 mm Hg, n = 12, p < 0.05). BMY7378 pretreatment to 1DeC/eC had no inhibitory effect, whereas bunazosin almost completely inhibited the pressor response (Fig. 1F). In 1BDeC/eC mice, the infusion of norepinephrine at the same rate of 1 e/kg/min did not elicit any increase in BP (n = 14; Fig. 1G).
Vascular Responsiveness of Mutant Mice. We measured contractile forces of isolated aortic segment induced by 1-AR agonists. Norepinephrine and phenylephrine induced concentration-dependent contractile responses in thoracic aortic segments from WT, 1BeC/eC, and 1DeC/eC, mice; however, the potency of norepinephrine was slightly reduced in 1BDeC/eC mice, and the reduction was more pronounced in 1DeC/eC mice (Fig. 2, A and B). The pD2 values for norepinephrine-induced contraction in WT, 1BeC/eC, and 1DeC/eC mice were 3.8 ± 0.5, 5.3 ± 0.5, and 190 ± 40 nM (n = 10eC16), respectively, and corresponding values for phenylephrine were 20 ± 2, 70 ± 10, and 840 ± 40 nM (n = 10eC16) for WT, 1BeC/eC, and 1DeC/eC mice, respectively. In contrast, the contractile response was apparently lost in 1BDeC/eC mice (Fig. 2, A and B). All mice had same levels of response to serotonin stimuli (Fig. 2C; n = 10eC16).
We next examined perfusion pressure of mesenteric arterial beds isolated from WT and mutant mice. The increase in the pressure to phenylephrine stimulation was significantly attenuated in 1DeC/eC and 1BDeC/eC mice compared with WT and 1BDeC/eC mice (Fig. 2D).
Cardiac Functions. The cardiac output of WT and mutant mouse groups were similar level (Table 5). Vascular resistances for the systemic vascular beds were calculated from cardiac output and MAP, and the calculated values were significantly decreased in 1DeC/eC and 1BDeC/eC mice. Vascular resistances were (in mm Hg/l/min) 8845 ± 3191, 7754 ± 2934, 7240 ± 1842, and 6782 ± 1983 for WT, 1BeC, 1DeC,, and 1BDeC, respectively. Myocardial contractility was monitored with either FS or ejection fraction and was significantly lower in 1DeC/eC and 1BDeC/eC mice than in WT and 1DeC/eC mice (Table 5). The left ventricular wall thickness, measured at the interventricular septum and posterior wall by echocardiogram, was comparable in all groups of mice (data not shown). The heart weight/body weight ratio did not significantly differ among the groups of mice (Table 1). In addition, there were no obvious differences among the groups of mice with respect to gross morphology or microscopic myocyte appearance of the hearts and aorta (data not shown).
Nephrectomy and Salt-Induced Hypertension Model. During subtotal nephrectomy and 1% saline loading, six of the 16 WT, six of the 15 1BeC/eC, seven of the 16 1DeC/eC, and six of the 15 1BDeC/eC died with general edema within 6 to 8 days without an appreciable change in BP, and nine to 10 surviving mice in each group were used for analysis. Hence, the Kaplan-Meier analysis at the 35th day showed no significant effect of the 1B gene and 1D gene ablation on cumulative survival (data not shown). Besides, no significant difference was observed with respect to the following parameters: plasma creatinine levels, ratios of residual kidney weight to body weight, blood cell counts, hematocrit and serum electrolytes (data not shown). Plasma creatinine levels and heart weight to body weight ratios significantly (p < 0.05) increased at the endpoint, and angiotensin I and II levels significantly (p < 0.05) decreased in all four groups, compared with those at baseline (Table 1). However, these endpoint data, except those of plasma catecholamines, did not show any significant differences among the groups of mice (Table 1). Although plasma catecholamine levels at baseline were not significantly different, at the end-point plasma norepinephrine, dopamine and total catecholamine levels of the WT and 1BDeC/eC mice were significantly higher than those of 1DeC/eC, and 1BDeC/eC, mice (Table 1).
Figure 3 shows the time course of SBP and HR changes during the 1% saline drinking period, as measured by tail-cuff monitoring. The baseline SBP values of WT and 1BDeC/eC mice were significantly higher than those of 1DeC/eC or 1BDeC/eC mice, whereas there was no significant difference in HR among the groups of mice. After 3 weeks from the beginning of salt loading, the WT and 1BDeC mice showed significantly higher SBP than the 1DeC/eC, and 1BDeC/eC mice (Fig. 3A). The endpoint SBP values were 144 ± 3, 141 ± 4, 124 ± 4, and 120 ± 4 mm Hg for WT (n = 10), 1BeC/eC (n = 9), 1DeC/eC (n = 9), and 1BDeC (n = 9), respectively (Fig. 3A). Eight of 10 surviving WT and seven of nine surviving 1BDeC/eC mice satisfied the HT criteria, as defined under Materials and Methods; however, only two of the nine surviving 1DeC/eC mice and two of the nine surviving 1BDeC mice satisfied the criteria. The endpoint HR by tail-cuff recording were 596 ± 13 bpm for WT mice (n = 10), 567 ± 30 bpm for 1BDeC/eC mice (n = 9), 584 ± 25 bpm for 1DeC/eC mice (n = 9), 583 ± 28 bpm for 1BDeC mice (n = 9), respectively (Fig. 3B). Unlike the SBP response, the HR change did not differ significantly among the groups at any time point during salt loading (Fig. 3B). At the endpoint, MAP and HR were confirmed directly under nonanesthetized conditions (Table 4). Consistent with the tail-cuff SBP measurements, the endpoint direct intraarterial MAP of 1DeC/eC and 1BDeC/eC mice was significantly (p < 0.05) lower than that of WT and 1BDeC/eC mice (Table 4). No significant difference was observed in direct intra-arterial HR among the groups of mice at the endpoint (Table 4).
Vascular Contraction of the HT Model Mice. To assess whether the salt-induced HT procedure caused altered catecholamine sensitivity in the vasculature, we examined the pressure responses to phenylephrine in the perfused arterial beds. As shown in Fig. 3C, the maximal pressure responses to phenylephrine at the endpoint were significantly (p < 0.05) enhanced compared with the baseline ones (Fig. 2D) in all groups of mice; however, the phenylephrine-induced changes in perfused pressure (>10 nmol) were significantly (p < 0.05) lower in 1DeC/eC and 1BDeC/eC mice, compared with WT and 1BeC/eC mice. The response was not significantly different either between 1BeC/eC and WT mice, or between 1DeC/eC and 1BDeC/eC mice (Fig. 3C).
Discussion
We investigated the consequences of simultaneous deletion of 1B- and 1D-AR function in BP regulation. RT-PCR and radioligand binding studies confirmed the deletion of both 1B-AR and 1D-AR gene in 1BDeC/eC double knockout mice and also indicated that the 1BDeC/eC mice had no apparent compensatory up-regulation of 1A-AR. Nonanesthetized 1DeC/eC and 1BDeC/eC mice had significantly lower basal SBP and MAP relative to WT and 1BDeC/eC mice, whereas all mice showed no significant change in HR. The pressor response of perfused mesenteric arterial beds to 1-AR stimulation, however, was not affected in 1BDeC/eC, and significantly reduced in both 1DeC/eC and 1BDeC/eC mice. Furthermore, in the mice lacking 1D-AR, but not 1BDeC/eC mice, development of HT was significantly attenuated compared with WT mice, further extending our previous observation that 1D-AR plays an important role in salt-sensitive BP increase, irrespective of coexpression of 1B-AR (Tanoue et al., 2002b). The present study shows that both 1B-AR and 1D-AR subtypes are involved in 1-AR-mediated pressor and vasoconstrictive responses, but to different extents.
RT-PCR and radioligand binding studies showed that the 1BDeC/eC mice expressed neither 1B-AR nor 1D-AR mRNA in any tissue examined and had no apparent compensatory up-regulation of 1A-AR. Saturation binding studies showed that the reduction of Bmax in 1BDeC/eC mice well corresponds to the summation of reduced Bmax values of 1BDeC/eC and 1DeC/eC mice. Thus, the reductions in Bmax of 1B-AR (in 1BeC/eC mice) and 1D-AR (in 1DeC/eC mice) were 41 and 11% in brain, 55 and 10% in heart, and 2 and 18% in kidney, respectively (Table 2), and those in 1BDeC/eC mice were 51% in brain, 64% in heart, and 15% in kidney, respectively. In addition, competition binding experiment in the brain with KMD-3213 confirmed the reduction of low-affinity sites in 1BeC/eC and 1DeC/eC mice, and no low-affinity site for KMD-3213 was detected in 1BDeC/eC double knockout mice.
One of the possible cardiovascular parameters that contribute to the lower resting BP of 1DeC/eC and 1BDeC/eC is a reduced systemic vascular resistance, as demonstrated in this study. Although the 1DeC/eC and 1BDeC/eC partially retained the ability to increase blood pressure in response to intravenously administered 1-agonists, circulating catecholamines of 1DeC/eC and 1BDeC/eC are similar level with WT and are not high enough to compensate decrease in resting BP. Both angiotensin II and vasopressin evoked similar blood pressure changes in WT and double knockout mice, suggesting that responsiveness to nonadrenergic stimuli was largely preserved in 1BDeC/eC mice. On the other hand, 1A-AR knockout mouse (1AeC/eC), but not 1ABeC/eC double knockout mouse, has been reported to have lower resting BP (O'Connell et al., 2003; Rokosh and Simpson, 2002). Because cardiac functions of 1AeC/eC), are in normal range, 1A-AR is required to maintain resting BP (Rokosh and Simpson, 2002). The BP of 1AeC/eC, mice was not different from that of WT, although cardiac output of the male knockout mouse was significantly decreased (O'Connell et al., 2003). In male 1ABeC/eC mice, the remaining vascular 1-AR, especially 1D-AR subtype, seems to compensate a negative effect of decreased cardiac output to maintain normal resting blood pressure; however, this assumption needs to be verified experimentally.
It is interesting that the maximum MAP of 1AeC/eC upon phenylephrine stimulation was about 10 to 15% lower than that of WT control, suggesting roles of 1B- and 1D-AR in the pressor response to the 1-agonist (Rokosh and Simpson, 2002). In contrast, maximum MAP response of 1BDeC/eC to phenylephrine stimulation was about 10% lower compared with WT. Expression analysis and radioligand binding studies performed on the 1AeC/eC (Rokosh and Simpson, 2002) and 1BDeC/eC knockout mice suggested that deletion of 1-AR resulted in a consistent reduction of total binding sites and up-regulation of remaining 1-AR gene was scarcely apparent. These results indicate that each 1-AR subtype could participate in the vasopressor response to circulating 1-agonist and that redundancy of 1-AR exists compared with the required number of 1-AR to obtaining maximum blood pressure response. Such a finding might have a clinical importance when studies on these knockout mice are translated to a clinical field of antihypertensive therapy.
The question as to which 1-AR subtype is involved in vasoconstricive responses in a particular vascular bed is not easy to clarify, because vascular smooth muscles express more than one 1-AR subtype (Zhong and Minneman, 1999; Guimaraes and Moura, 2001). In addition, the distribution of the 1-AR subtype in blood vessels markedly varies depending on species and vessels (Daniel et al., 1999; Piascik and Perez, 2001). We studied contractile responses in two types of blood vessels: thoracic aorta and mesenteric artery. Our data on aortic contractile response and on perfusion pressure of mesenteric vascular beds are in good agreement with previous reports (Cavalli et al., 1997; Daly et al., 2002; Hedemann and Michel, 2002). Contraction of mouse aorta was shown to be mainly mediated by 1D-AR (Cavalli et al., 1997; Daly et al., 2002) and of mesenteric artery via 1A-AR (Hedemann and Michel, 2002). Hence, our data confirmed the previous observation by Daly et al. (2002) that 1B-AR plays a relatively small role in 1-AR-mediated contraction of mouse aorta. In addition, relatively small contribution of 1D-AR in the contraction of mesenteric arterial beds was observed in a previous study (Hedemann and Michel, 2002). This, however, does not necessarily mean that the role of 1D-AR in blood pressure regulation is small. It was recently reported in the contraction of small femoral resistant arteries that 1A-AR, but not 1D-AR, mainly mediates the contractile responses to exogenous norepinephrine, whereas 1D-AR seems to be activated by neurally released norepinephrine (Zacharia et al., 2004a,b). Because both studies by Hedemann and Michel and ours examined the contractile responses to the exogenously applied catecholamines, the relative contribution of 1D-AR seems to be small. Hence, further studies will be required to clarify the relative contribution of each subtype in the sympathetic regulation of neuronally stimulated and blood-borne catecholamine-stimulated pressor responses, in vivo in particular.
The 1-AR-stimulated pressor responses seen in 1BDeC/eC mice in the present study may further support the idea that the remaining 1-AR, which is mainly regarded to be probably 1A-AR subtype, is a vasopressor expressed in resistance arteries (Rokosh and Simpson, 2002). A number of previous pharmacological and mRNA expression studies have indicated the contribution of 1A-AR to vascular contraction (Leech and Faber, 1996; Piascik and Perez, 2001; Rokosh and Simpson, 2002). Furthermore, Rokosh and Simpson (2002) showed histochemically that Lac-Z, whose gene substituted for the 1A-AR gene in their 1A-knockout mouse, was expressed in peripheral arteries, such as mesenteric artery, but not expressed in the major conducting arteries, such as the thoracic aorta. In addition, the pressor response to a potent 1A-AR-selective agonist A61063 in 1BDeC/eC mice was intact and comparable with WT, indicating that this ligand is selective for 1A-AR-mediated function.
Our next focus in this study was on a direct comparison of 1-AR subtypes in vivo, in terms of their causative roles of salt-sensitive hypertension. Distinct BP patterns of 1BDeC/eC and 1BDeC/eC mice were clear evidence indicating the 1D-AR plays a crucial role in raising BP in this model. Observations in this and previous studies suggest a critical role of 1D-AR on increased sensitivity to vasoconstriction, especially in hypertensive state (Clements et al., 1997; Daly et al., 2002; Tanoue et al., 2002a; Chalothorn et al., 2003). Altered sympathetic activity is another prominent feature of HT. We found that the circulating catecholamine levels of 1BDeC/eC and 1DeC/eC mice under salt loading were less than those of WT. Because plasma catecholamine levels correlate well with spillover from sympathetic nerves in organs (Grassi, 1998; Esler and Kaye, 2000), lower plasma catecholamine levels of 1BDeC/eC and 1DeC/eC mice indicate suppression of sympathetic outflow. In fact, the 1-blocker prazosin has been shown to act on 1-AR in the central nervous system (CNS) and suppress sympathetic outflow (Hoffman, 2001). In mouse CNS, about 10% of 1-AR is 1D-AR subtype, as seen in this study. Although contribution of central 1D-AR to the regulation of sympathetic outflow need to be further examined, our current data clearly indicate that 1D-AR gene knockout leads to decrease in plasma catecholamine levels and in the antihypertensive effects on salt-sensitive hypertension. Using the same hypertension model, the mice lacking one copy of 2B-AR gene had attenuated BP increase compared with the WT group (Makaritsis et al., 1999). It is, therefore, of interest to explore a possibility of functional relationship between 2B-AR and 1D-AR subtypes, because both are found in the CNS and activated by the same agonist (Gavras and Gavras, 2001; Tanoue et al., 2002b).
In conclusion, three 1-AR subtypes differently participate in systemic blood pressure regulation. Ablation of 1D-AR, but not of 1B-AR, reduced resting blood pressure by reducing peripheral resistance. Pressor response to 1-agonist is suppressed according to the number of 1-AR gene deleted; however, an increase in BP of double knockout mice suggests that functional redundancy could exist in 1-AR-mediated pressor response. Furthermore, 1D-AR is an important receptor subtype in the development of secondary HT accompanying acute renal dysfunctions.
C.H. and T.K. contributed equally to this work.
doi:10.1124/mol.104.007500.
References
ALLHAT Collaborative Research Group (2000) Major cardiovascular events in hypertensive patients randomized to doxazosin vs chlorthalidone: the antihypertensive and lipid-lowering treatment to prevent heart attack trial (ALLHAT). J Am Med Assoc 283: 1967eC1975.
Alonso-Llamazares A, Zamanillo D, Casanova E, Ovalle S, Calvo P, and Chinchetru MA (1995) Molecular cloning of alpha 1d-adrenergic receptor and tissue distribution of three alpha 1-adrenergic receptor subtypes in mouse. J Neurochem 65: 2387eC2392.
Cavalli A, Lattion AL, Hummler E, Nenniger M, Pedrazzini T, Aubert JF, Michel MC, Yang M, Lembo G, Vecchione C, et al. (1997) Decreased blood pressure response in mice deficient of the alpha1b-adrenergic receptor. Proc Natl Acad Sci USA 94: 11589eC11594.
Chalothorn D, McCune DF, Edelmann SE, Tobita K, Keller BB, Lasley RD, Perez DM, Tanoue A, Tsujimoto G, Post GR, et al. (2003) Differential cardiovascular regulatory activities of the 1B- and 1D-adrenoceptor subtypes. J Pharmacol Exp Ther 305: 1045eC1053.
Clements ML, Banes AJ, and Faber JE (1997) Effect of mechanical loading on vascular alpha 1D- and alpha 1B-adrenergic receptor expression. Hypertension 29: 1156eC1164.
Daly CJ, Deighan C, McGee A, Mennie D, Ali Z, McBride M, and McGrath JC (2002) A knockout approach indicates a minor vasoconstrictor role for vascular alpha1B-adrenoceptors in mouse. Physiol Genomics 9: 85eC91.
Daniel EE, Brown RD, Wang YF, Low AM, Lu-Chao H, and Kwan CY (1999) -Adrenoceptors in canine mesenteric artery are predominantly 1A subtype: pharmacological and immunochemical evidence. J Pharmacol Exp Ther 291: 671eC679.
Esbenshade TA, Hirasawa A, Tsujimoto G, Tanaka T, Yano J, Minneman KP, and Murphy TJ (1995) Cloning of the human alpha 1d-adrenergic receptor and inducible expression of three human subtypes in SK-N-MC cells. Mol Pharmacol 47: 977eC985.
Esler M and Kaye D (2000) Sympathetic nervous system activation in essential hypertension, cardiac failure and psychosomatic heart disease. J Cardiovasc Pharmacol 35: S1eCS7.
Gavras I and Gavras H (2001) Role of alpha2-adrenergic receptors in hypertension. Am J Hypertens 14: 171SeC177S.
Goetz AS, King HK, Ward SD, True TA, Rimele TJ, and Saussy DL Jr (1995) BMY 7378 is a selective antagonist of the D subtype of alpha 1-adrenoceptors. Eur J Pharmacol 272: R5eCR6.
Grassi G (1998) Role of the sympathetic nervous system in human hypertension. J Hypertens 16: 1979eC1987.
Guimaraes S and Moura D (2001) Vascular adrenoceptors: an update. Pharmacol Rev 53: 319eC356.
Hedemann J and Michel MC (2002) Alpha1A-adrenoceptors mediate contraction of mouse mesenteric artery. Recept Channels 8: 125eC126.
Hieble JP, Bylund DB, Clarke DE, Eikenburg DC, Langer SZ, Lefkowitz RJ, Minneman KP, and Ruffolo RR Jr (1995) International Union of Pharmacology. X. Recommendation for nomenclature of 1-adrenoceptors: consensus update. Pharmacol Rev 47: 267eC270.
Hoffman BB (2001) Cetecholamines, sympathomimetic drugs and adrenergic receptor antagonists, in Goodman & Gilman's The Pharmacological Basis of Therapeutics (Hardman JG, Limbird LE, and Goodman Gilman A eds) pp 215eC268, McGraw-Hill Book Company, New York.
Johns C, Gavras I, Handy DE, Salomao A, and Gavras H (1996) Models of experimental hypertension in mice. Hypertension 28: 1064eC1069.
Kaplan EL and Meier P (1958) Nonparametric estimation from incomplete observations. J Am Stat Assoc 53: 457eC481.
Leech CJ and Faber JE (1996) Different alpha-adrenoceptor subtypes mediate constriction of arterioles and venules. Am J Physiol 270: H710eCH722.
Makaritsis KP, Handy DE, Johns C, Kobilka B, Gavras I, and Gavras H (1999) Role of the alpha2B-adrenergic receptor in the development of salt-induced hypertension. Hypertension 33: 14eC17.
Michelotti GA, Price DT, and Schwinn DA (2000) Alpha 1-adrenergic receptor regulation: basic science and clinical implications. Pharmacol Ther 88: 281eC309.
Munson PJ and Rodbard D (1980) Ligand: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107: 220eC239.
Nasa Y, Yoshida H, Urata M, Uchibayashi K, Tsunoda Y, Kamigata K, and Takeo S (1998) Effects of the antihypertensive agent, cicletanine, on noradrenaline release and vasoconstriction in perfused mesenteric artery of SHR. Br J Pharmacol 123: 427eC434.
O'Connell TD, Ishizaka S, Nakamura A, Swigart PM, Rodrigo MC, Simpson GL, Cotecchia S, Rokosh DG, Grossman W, Foster E, and Simpson PC (2003) The alpha(1A/C)- and alpha(1B)-adrenergic receptors are required for physiological cardiac hypertrophy in the double-knockout mouse. J Clin Investig 111: 1783eC1791.
Piascik MT and Perez DM (2001) 1-Adrenergic receptors: new insights and directions. J Pharmacol Exp Ther 298: 403eC410.
Rokosh DG and Simpson PC (2002) Knockout of the alpha 1A/C-adrenergic receptor subtype: the alpha 1A/C is expressed in resistance arteries and is required to maintain arterial blood pressure. Proc Natl Acad Sci USA 99: 9474eC9479.
Sabath DE, Broome HE, and Prystowsky MB (1990) Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene 91: 185eC191.
Shibata K, Foglar R, Horie K, Obika K, Sakamoto A, Ogawa S, and Tsujimoto G (1995) KMD-3213, a novel, potent, 1a-adrenoceptor-selective antagonist: characterization using recombinant human 1-adrenoceptors and native tissues. Mol Pharmacol 48: 250eC258.
Stanasila L, Perez JB, Vogel H, and Cotecchia S (2003) Oligomerization of the 1a- and 1b-adrenergic receptor subtypes. Potential implications in receptor internalization. J Biol Chem 278: 40239eC40251.
Takeo S, Tanonaka K, Matsumoto M, Miyake K, and Minematsu R (1988) Cardioprotective action of -blocking agents, phentolamine and bunazosin, on hypoxic and reoxygenated myocardium. J Pharmacol Exp Ther 246: 674eC681.
Tanoue A, Endo F, Kitano A, and Matsuda I (1990) A single nucleotide change in the prolidase gene in fibroblasts from two patients with polypeptide positive prolidase deficiency. Expression of the mutant enzyme in NIH 3T3 cells. J Clin Investig 86: 351eC355.
Tanoue A, Koba M, Miyawaki S, Koshimizu TA, Hosoda C, Oshikawa S, and Tsujimoto G (2002a) Role of the alpha1D-adrenegric receptor in the development of salt-induced hypertension. Hypertension 40: 101eC106.
Tanoue A, Nasa Y, Koshimizu T, Shinoura H, Oshikawa S, Kawai T, Sunada S, Takeo S, and Tsujimoto G (2002b) The alpha(1D)-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction. J Clin Investig 109: 765eC775.
Uberti MA, Hall RA, and Minneman KP (2003) Subtype-specific dimerization of 1-adrenoceptors: effects on receptor expression and pharmacological properties. Mol Pharmacol 64: 1379eC1390.
Zacharia J, Hillier C, and MacDonald A (2004a) Alpha1-adrenoceptor subtypes involved in vasoconstrictor responses to exogenous and neurally released noradrenaline in rat femoral resistance arteries. Br J Pharmacol 141: 915eC924.
Zacharia J, Hillier C, and Macdonald A (2004b) Pharmacological characterization of alpha(1)-adrenoceptors in mouse isolated femoral small arteries. Eur J Pharmacol 503: 155eC163.
Zhong H and Minneman KP (1999) Alpha1-adrenoceptor subtypes. Eur J Pharmacol 375: 261eC276., 百拇医药(Chihiro Hosoda, Taka-aki )
Department of Pharmacology, Tokyo University of Pharmacy and Life Science, Horinouchi, Hachioji, Tokyo, Japan (Y.N., R.O., T.T., S.F., S.T.)
Department of Urology, Faculty of Medicine, University of Tokyo, Tokyo, Japan (C.H., T.Ki.)
Institut de Pharmacologie et Toxicologie, Universit de Lausanne, Lausanne, Switzerland (S.C.)
Department of Genomic Drug Discovery Science, Graduate School of Pharmaceutical Sciences, Kyoto University Faculty of Pharmaceutical Sciences, Kyoto University, Kyoto, Japan (G.T.)
Abstract
To study the functional role of individual 1-adrenergic (AR) subtypes in blood pressure (BP) regulation, we used mice lacking the 1B-AR and/or 1D-AR with the same genetic background and further studied their hemodynamic and vasoconstrictive responses. Both the 1D-AR knockout and 1B-/1D-AR double knockout mice, but not the 1B-AR knockout mice, had significantly (p < 0.05) lower levels of basal systolic and mean arterial BP than wild-type mice in nonanesthetized condition, and they showed no significant change in heart rate or in cardiac function, as assessed by echocardiogram. All mutants showed a significantly (p < 0.05) reduced catecholamine-induced pressor and vasoconstriction responses. It is noteworthy that the infusion of norepinephrine did not elicit any pressor response at all in 1B-/1D-AR double knockout mice. In an attempt to further examine 1-AR subtype, which is involved in the genesis or maintenance of hypertension, BP after salt loading was monitored by tail-cuff readings and confirmed at the endpoint by direct intra-arterial recording. After salt loading, 1B-AR knockout mice developed a comparable level of hypertension to wild-type mice, whereas mice lacking 1D-AR had significantly (p < 0.05) attenuated BP and lower levels of circulating catecholamines. Our data indicated that 1B- and 1D-AR subtypes participate cooperatively in BP regulation; however, the deletion of the functional 1D-AR, not 1B-AR, leads to an antihypertensive effect. The study shows differential contributions of 1B- and 1D-ARs in BP regulation.
Catecholamines released from sympathetic nerve terminals cause vascular smooth muscle contraction primarily by activating 1-adrenergic receptors (1-ARs) in arteries (Hoffman, 2001). Thus, blockade of 1-AR leads to a fall in peripheral vascular resistance. Because of their consistent effect in lowering systemic blood pressure (BP), 1-AR blockers have been widely used as an antihypertensive drug. However, a large clinical trial unexpectedly disclosed that doxazosin, a nonselective 1-AR antagonist, was associated with an increased incidence of heart failure (ALLHAT Collaborative Research Group, 2000). This raised a serious concern about the long-term use of 1-AR antagonists in the treatment of hypertension (HT) (ALLHAT Collaborative Research Group, 2000). On the other hand, clinical efficacy of a subtypeselective inhibition of 1-AR has not been fully determined.
The three known 1-AR subtypes (1A-, 1B-, and 1D-AR) participate in the constellation of 1-adrenergic activities in the cardiovascular system (Hieble et al., 1995). All of these receptors are coupled to Ca2+ signaling, leading to smooth muscle contraction (Esbenshade et al., 1995; Hieble et al., 1995). Elucidation of the physiological and pathophysiological roles of the specific 1-AR subtype has been hampered, because the 1-AR subtypes are coexpressed in the same arterial smooth muscles with different ratios (Michelotti et al., 2000; Piascik and Perez, 2001) and sufficiently subtype-selective agonists and antagonists have not been available (Esbenshade et al., 1995; Guimaraes and Moura, 2001; Piascik and Perez, 2001). In addition, recent biochemical and pharmacological studies confirmed the potential role of dimerization of distinct 1-AR subtypes in controlling their expression and pharmacological properties (Stanasila et al., 2003; Uberti et al., 2003). Therefore, complex interactions of subtypes could be expected when subtypes are coexpressed in a same smooth muscle cell.
In this study, we used three mice groups specifically lacking the 1B-AR and/or 1D-AR subtypes (1BeC/eC, 1DeC/eC, and 1BDeC/eC) to examine the individual and cooperative roles of these receptor subtypes in BP regulation, both under basal conditions and in the development of salt-induced experimental HT. In addition, responsiveness to intravenous infusion of catecholamines was compared by direct measurement of arterial pressure. Our data showed that 1B- and 1D-ARs play distinctive contributions to the resting and agonist-stimulated BP regulations, particularly to the progression of hypertensive state.
Materials and Methods
Generation of mice lacking both the 1B-AR and 1D-AR subtypes. 1BeC/eC and 1DeC/eC mice have been generated and characterized previously (Cavalli et al., 1997; Tanoue et al., 2002b). Disruption of the 1B-or 1D-AR gene was achieved using a positive-negative selection strategy to effect homologous recombination in embryonic stem cells, using the targeting construct. The strain background of both 1BeC/eC and 1DeC/eC mice was a mixture of 129Sv and C57Bl6/J. Double knockout 1BDeC/eC mice were generated by mixture of homozygous 1BeC/eC and 1DeC/eC mice. The resulting F1 generation of compound heterozygotes was subsequently intercrossed to generate F2 mice with all possible combinations of 1B- and 1D-AR gene disruptions. Mice were genotyped for both 1B- and 1D-AR disruptions by Southern blotting or PCR of mouse tail biopsies (Cavalli et al., 1997; Tanoue et al., 2002b). According to Mendel's law, 1/16 of progeny were predicted to be homozygous-deficient for 1B- and 1D-AR, and 1/16 of progeny were predicted to be wild type (WT) for both 1B- and 1D-AR. The F2 double knockout 1BDeC/eC mice were bred to produce double knockout mice used in our experiments. The wild-type F2 mice were bred to produce WT control mice. Thus, the overall strain contributions in the WT, 1BeC/eC, 1DeC/eC and 1BDeC/eC mice were equivalent. Animals were housed in micro-isolator cages in a pathogen-free barrier facility. All experimentation was performed under approved Institutional Guidelines. All mice used in this study were 7 to 9 weeks old male ones.
RT-PCR Analysis. Total RNA from different mouse tissues was prepared using Isogen (Nippon Gene Co. Ltd., Tokyo, Japan). Total RNA of 5 e was treated with RNase-free DNase (TaKaRa Bio Co., Tokyo, Japan) and reverse-transcribed using random hexamers (Tanoue et al., 1990). One-tenth of each cDNA sample was amplified by PCR with a receptor-specific primer set and a primer set specific for GAPDH (Sabath et al., 1990). Each sample contained the upstream and downstream primers (10 pmol of each), 0.25 mM of each dNTP, 50 mM KCl, 10 mM Tris-HCl, pH 8.6, 1.5 mM MgCl2, and 2.5 U of TaqDNA polymerase (TaKaRa Bio Co.). Thermal cycling was performed for 1 min at 94°C, 1 min at 56°C, and 2 min at 72°C for 27 cycles. The upstream and downstream primers (5'3') were AGGCTGCTCAAGTTTTCTCG and CAGATTGGTCCTTTGGCACT for 1A-AR (275 bp), GGGAGAGTTGAAAGATGCCA and TTGGTACTGCTGAGGGTGTC for 1B-AR (752 bp), and CGCTGTGGTGGGAACCGGCAG and ACAGCTGCACTCAGTAGCAGGTCA for 1D-AR (282 bp). The upstream primer for the 1A-AR or the 1B-AR gene was located within the first exon, and the downstream primer for the 1A-AR or the 1B-AR gene was located within the second exon. The primers for the 1D-AR gene were located within the first exon, and the forward primer was within the region replaced with the Neo in the mutant allele. The primers were derived from the murine 1A-AR, 1B-AR, and 1D-AR sequences (Alonso-Llamazares et al., 1995). The GAPDH primers (5'3') were GGTCATCATCTCCGCCCCTTC upstream and CCACCACCCTGTTGCTGTAG downstream (662 bp). Control PCR reactions also were performed on noneCreverse-transcribed RNA to exclude any contamination by genomic DNA. The amplified DNAs were analyzed on a 1.5% agarose gel with 100-bp DNA marker (New England Biolabs, Beverly, MA). The specificity of the amplified DNA fragments was determined by Southern blot analysis using receptor-specific 32P-labeled probes (Alonso-Llamazares et al., 1995).
Radioligand Ligand Binding Study. Radioligand binding studies were performed on membrane preparations of mouse native tissues (Shibata et al., 1995). In brief, whole brain, heart, liver, kidney, and aorta were dissected from mice, placed in lysis buffer A (250 mM sucrose, 5 mM Tris-HCl, and 1 mM MgCl2, pH 7.4), and homogenized with a Polytron homogenizer (Kinematica, Basel, Switzerland) at 4°C, at speed 7 for 10 s. The homogenate was then centrifuged at 1000g at 4°C for 10 min to remove the nuclei. The supernatant fraction was centrifuged at 35,000g for 20 min at 4°C. The resulting pellet was re-suspended in binding buffer B (50 mM Tris-HCl, 10 mM MgCl2, and 10 mM EGTA, pH 7.4) and was frozen at eC80°C until assay. Protein concentration was measured using the bicinchoninic acid protein assay kit (Pierce Chemical, Rockford, IL). Radioligand binding studies were performed using 125I-(2--(4-hydroxyphenyl)-ethylaminomethyl)-tetralone (125I-HEAT; 2200 Ci/mmol; PerkinElmer Life and Analytical Sciences, Boston, MA) or [7-methoxy-3H]prazosin ([3H]prazosin; 83.8 Ci/mmol; PerkinElmer Life and Analytical Sciences). In brief, 20 to 100 e of membrane protein from brain, aorta, and heart were incubated with 125I-HEAT, and membranes from liver and kidney were incubated with [3H]prazosin in a final volume of 250 e of binding buffer B in the presence or absence of competing drugs for 60 min at 25°C. The incubation was terminated by addition of the ice-cold buffer B and immediate filtration through Whatman GF/C glass fiber filters with a Brandel cell harvester (model-30; Brandel Inc., Gaithersburg, MD). Each filter was collected, and the radioactivity was measured. Binding assays were always performed in duplicate. For competition curve analysis, each assay contained about 100 pM 125I-HEAT or [3H]prazosin. Nonspecific binding was defined as binding displaced by 10 e phentolamine.
Measurement of BP and HR. Systolic BP (SBP) and heart rate (HR) were measured in conscious mice with a computerized tail-cuff system (BA-98A system; Softron Co., Tokyo, Japan) that determines SBP using a photoelectric sensor (Tanoue et al., 2002b). Before the study was initiated, at least 3 days of training sessions were provided for the mice to become accustomed to the tail-cuff procedure. Sessions of recorded measurements were then made form 1:00 to 5:00 PM daily on three consecutive days. Each session included more than 10 tail-cuff measurements. Mean arterial pressure (MAP) and HR were also measured in nonanesthetized mice by an intra-arterial catheter (Tanoue et al., 2002b). After cervical incision on mice anesthetized with sodium pentobarbital (40 mg/kg i.p.), a stretched intramedic PE-10 polyethylene catheter (Clay Adams, Parsippany, NJ) was inserted into the right carotid artery. The catheter was tunneled through the neck and then placed in a subcutaneous pouch in the back. After a minimum of 24-h recovery, mice were placed in Plexiglas tubes to partially restrict their movements, and the saline-filled catheter was removed from the pouch and connected to a pressure transducer (DX-360; Nihonkohden, Tokyo, Japan), and MAP was recorded on a thermal pen recorder (RTA-1200; Nihonkohden). Measurement of HR was triggered from changes in MAP (AT-601G; Nihonkohden). To examine pressor responses in nonanesthetized mice, drugs in 30 e of injection volume (1 e/g of mouse body weight) were administered through catheter inserted into the right femoral vein as a bolus at 15- to 20-min intervals after ensuring MAP and HR had returned to baseline levels.
The effect of 1-antagonists on the norepinephrine-induced pressor response was examined in each mouse group. After propranolol (1 mg/kg) treatment, either bunazosin hydrochloride (10 e/kg i.v.; Eisai Co. Ltd., Tokyo, Japan) or BMY7378 (100 e/kg i.v.; Sigma/RBI, Natick, MA) was administered 10 min before the continuous infusion of norepinephrine (1 e/kg/min i.v. for 5 min) using a micro-syringe pump (CFV-2100; Nihonkohden).
Measurement of Blood Chemistries. After 1 h of stable anesthesia (80 mg/kg pentobarbital, intraperitoneally), blood was drawn slowly from the right carotid arterial line to measure total plasma catecholamine levels (epinephrine, norepinephrine, and dopamine), angiotensin I and II levels, creatinine levels, blood cell counts, hematocrit and serum electrolytes. Plasma catecholamine levels were determined by high pressure liquid chromatography using commercially available reagents (Tosho Co., Tokyo, Japan). Plasma angiotensin I and II were measured with a radioimmunoassay kit (PerkinElmer Life and Analytical Sciences) and plasma creatinine by a colorimetric kit (Sigma-Aldrich, St. Louis, MO).
Measurement of Aortic Contraction. The thoracic aorta was prepared for aortic contractile responses to drugs as described previously (Tanoue et al., 2002b). In brief, the excised thoracic aorta was cleaned and cut into 1 mm segments. These segments were suspended in isolated tissue baths filled with 10 ml Krebs-Henseleit bicarbonate buffer containing timolol (3 e), continuously bubbled with a gas mixture of 5% CO2 and 95% O2 at 37°C. One end of the aortic segment was connected to a tissue holder and the other to an isometric force transducer. Aortic segments were equilibrated for 60 min under a resting tension of 0.5 g, and the buffer was replaced every 15 min. In a preliminary experiment, the length of the smooth muscle was increased stepwise during the equilibration period to adjust passive wall tension to 0.5 g; this resting tension was found to be optimal for KCl (40 mM)-induced aortic contraction of mice weighing 20 to 23 g. Care was taken to avoid endothelial damage; functional integrity of the endothelium was assessed using acetylcholine (10 e). Only intact segments were used for further analysis.
Pressor Response in Perfused Mesenteric Arterial Beds. The mesenteric arterial beds were prepared to measure the perfusion pressure (Nasa et al., 1998). The superior mesenteric artery of diethyl ether-anesthetized mice was dissected and a stainless steel cannula (27-gauge syringe) was inserted. The preparations were perfused with Krebs-Henseleit solution equilibrated with a mixture of 95% O2 and 5% CO2 (PO2 >600 mm Hg). The entire ileum was dissected longitudinally at the opposite site of mesenteric vasculature. The preparation was placed in a chamber with a warm water jacket to maintain at 37°C. The perfusion flow rate was maintained at 1.0 ml/min using a peristaltic pump. Perfusion pressure was measured through a branch of the perfusion cannula by means of a pressure transducer (TP-400T; Nihonkohden) connected to a carrier amplifier (AP-621G; Nihonkohden) and recorded on a thermal pen recorder (WT-645G; Nihonkohden). The preparations were equilibrated for 30 min before administration of phenylephrine.
Histological Analysis of Heart and Thoracic Aorta. Heart-to-body weight ratios were calculated as milligrams per gram. For histological analysis, heart and thoracic aorta were fixed with perfusion of phosphate-buffered saline plus 10% formalin. Several sections of hearts and aorta were obtained for gross morphological analysis and then paraffin embedded for thin sectioning followed by hematoxylin and eosin staining.
Echocardiography. Quantitative echocardiographic measurements were performed on lightly anesthetized, spontaneously breathing mice (Tanoue et al., 2002b). Mice were anesthetized (40 mg/kg pentobarbital i.p.), the chest area was shaved, and ultrasonic gel was applied. The measurements with the SONOS-5500 system (Philips Medical Systems, Andover, MA) used a dynamically focused symmetrical annular array transducer (12.5 MHz) for two-dimensional, M-mode, and Doppler imaging. The parasternal long and short axes and four chamber views were visualized. For quantitative analysis, measurements were performed in three to five consecutive cardiac cycles. Cardiac parameters determined include interventricular septal thickness, posterior wall thickness, left ventricular internal dimension in diastole (LVIDd) and in systole (LVIDs), and HR. LVIDd and LVIDs were normalized to body weight, and percentage of fractional shortening (%FS) was calculated as 100 x [(LVIDdeCLVIDs)/LVIDd]. Cardiac output was calculated from Doppler echocardiography using the equation [ x (Ao)2 x VTI x HR]/4, where Ao was the diameter of the aortic artery, VTI was the Doppler velocity time integral in left ventricular outflow, and HR was determined from the simultaneous monitoring of electrocardiogram.
Nephrectomy and Salt-Induced HT. Mice, weighing 18 to 23 g, were subjected to two steps of nephrectomy protocol (Johns et al., 1996). In brief, both poles of the left kidney were excised under anesthesia with intraperitoneal sodium pentobarbital (50 mg/kg), leaving a small amount of residual renal tissue around the hilum and preserving the ureter and hilar vessels. The excised renal tissues were weighed, and the ratios of those organs to the body weights were calculated. After a 7-day recovery period, the right kidney was removed, leaving 25% of the total renal mass. Twenty-four hours after the second operation, the animals were maintained with 1% saline as drinking water for 35 days. SBP and HR were monitored by tail-cuff system as described above. At the endpoint, SBP and HR were recorded for three consecutive days and averaged. HT was defined as follows: tail-cuff SBP that reached 150 mmHg, or an increase of >40 mmHg above the baseline.
Data Analysis. All values are expressed as means ± S.E.M. Differences among each group of mice were assessed by ANOVA with subsequent Bonferroni's post hoc test for multiple comparisons. Data from the radioligand binding study were analyzed using the iterative nonlinear regression program LIGAND (Munson and Rodbard, 1980). The presence of one, two or three different binding sites was assessed using the F-test in the program. Cumulative survival curves were constructed by the Kaplan-Meier method (Kaplan and Meier, 1958), and differences between the curves were tested for significance using the log-rank statistic. Statistical significance was established at a value of p < 0.05. Apparent pD2 value, agonist dose or concentration that gives half-maximal response, was calculated from dose-response or concentration-response curves constructed from experiments. Difference among the concentration-response curves was evaluated by two-way ANOVA, if applicable.
Results
The 1BeC/eC and 1DeC/eC single knockout mice, which have the same genetic background, were crossed to produce the 1BDeC/eC double knockout mice. The 1BDeC/eC mice were viable at the expected Mendelian ratios from heterozygote intercrosses. They developed normally and showed no gross abnormalities. Analysis of venous blood samples from these mutant mice showed no significant difference in the following parameters: plasma creatinine, plasma catecholamine, epinephrine, norepinephrine, angiotensin I and II levels (baseline values in Table 1), blood cell counts, hematocrit, and serum electrolytes (data not shown).
Expression of 1-AR in 1BDeC/eC Mice. We confirmed the lack of 1B-AR and 1D-AR expression in the mutant mice by RT-PCR and by radioligand binding studies. RT-PCR analysis showed that the 1BDeC/eC mice expressed neither 1B-AR nor 1D-AR mRNA in any tissue examined (brain, heart, aorta, kidney, and liver; data not shown) and had no apparent compensatory up-regulation of 1A-AR mRNA. Corresponding well with the RT-PCR results, radioligand binding studies showed a decreased 1-AR binding capacity in the brain, heart, and kidney of knockout mice (Table 2). 1B-AR and 1D-AR are predominant 1-AR in the liver and aorta, respectively (Cavalli et al., 1997; Tanoue et al., 2002b), and 1-AR ligand-binding capacities in the liver and aorta of 1BDeC/eC mice were markedly diminished (Table 2), indicating that no significant compensatory increase of 1-AR binding site in these mice. In accordance with data of saturation binding experiments, competition binding experiments using the 1A-AR-selective antagonist KMD-3213 (Shibata et al., 1995) showed that only high-affinity binding site for KMD-3213 was detected in the brain of 1BDeC/eC mice (KH = 0.26 nM), whereas two sites were detected in WT, 1BeC/eC, and 1DeC/eC mice (Table 3).
Specific binding was measured with 125I-HEAT for the brain, aorta, and heart, and with [3H]prazosin for the liver and kidney as described under Materials and Methods. Each value is the means ± S.E.M. of four to six different experiments.
Inhibition of specific 125I-HEAT binding by KMD-3213 was determined in membrane preparations from the mouse brain. The best two-site fit was determined by nonlinear regression analysis of the averaged curve, and high- and low-affinity sites for KMD-3213.
Hemodynamic Parameters. We measured systemic BP in the series of mutant mice to delineate consequences of deleting two 1-AR subtypes. When resting SBP of conscious mice was monitored by tail-cuff, the mean SBP values were significantly low in two mouse groups deleted with 1D-AR gene, 1DeC/eC, and 1BDeC/eC, compared with those of WT and 1BeC/eC mice (99 ± 2 mm Hg for WT, n = 10; 99 ± 3 mm Hg for 1BeC/eC, n = 9; 93 ± 2mm Hg for 1DeC/eC, n = 9; 92 ± 2mm Hg for 1BDeC/eC, n = 9, p < 0.05). These differences were also confirmed by direct pressure measurement by intra-arterial catheter (Table 4). Averaged HR during the BP monitoring was a similar level in all mice groups in tail-cuff recording (542 ± 16 bpm for WT, n = 10; 520 ± 20 bpm for 1BDeC/eC mice, n = 9; 533 ± 17 bpm for 1DeC/eC mice, n = 9; and 516 ± 28 bpm for 1BDeC/eC mice, n = 9) and in direct intra-arterial recording (Table 4).
MAP and HR were measured in nonanesthetized mice as described under Materials and Methods. Values are the mean ± S.E.M. of nine to 18 mice.
We next examined the pressor responses to several vasoactive agents in nonanesthetized mice. As 1-AR agonists, we administered phenylephrine (0.1eC300 e/kg), norepinephrine (0.1eC10.0 e/kg), or the 1A-selective agonist A61603 (0.01eC 3.0 e/kg). The analysis showed a significant difference in the pressor response curves to phenylephrine between WT and 1BDeC/eC mice (Fig. 1A). The pD2 values for phenylephrine in WT, 1BeC/eC, 1DeC/eC and 1BDeC/eC mice were 9 ± 2, 10 ± 2, 12 ± 1, and 19 ± 3 e/kg (n = 15eC22), respectively. The responses to norepinephrine of each mutant mouse were also significantly less than that of WT (Fig. 1B). The maximal plateau level of pressor responses to norepinephrine could not be monitored, because high doses of norepinephrine frequently caused circulatory collapse because of its cardiac toxicity. Unlike phenylephrine or norepinephrine, WT and 1BDeC/eC mice showed similar pressor response to A61603 infusion (Fig. 1C). None of the mutant mice exhibited a significant alteration in pressor responses to nonadrenergic vasoactive stimuli, such as angiotensin II or vasopressin. Increases in BP by intravenous administration of angiotensin II (100 ng/kg) were 31.4 ± 2.8, 33.4 ± 2.4, 30.8 ± 3.6, and 33.4 ± 2.4 mm Hg in WT, 1BeC/eC, 1DeC/eC, and 1BDeC/eC (n = 6eC11), respectively. Vasopressin (100 ng/kg)-induced BP increases were 12 ± 0.6, 19.5 ± 3.2, 23.8 ± 8.7, and 22.4 mm Hg in WT, 1BeC/eC, 1DeC/eC, and 1BDeC/eC (n = 4eC9), respectively.
We further assessed the contribution of each subtype to the 1-AR-mediated pressor response. Continuous infusion of norepinephrine (1 e/kg/min, for 5 min) promptly induced a significant increase in BP (23 ± 2 mm Hg, n = 16), which lasted during the administration of norepinephrine in WT mice (Fig. 1D). This BP increase was suppressed partly by 100 e/kg BMY7378, an 1D-selective antagonist (Goetz et al., 1995), and almost lost by 10 e/kg bunazosin, a nonselective 1-AR antagonist (Takeo et al., 1988). In 1BDeC/eC mice, the norepinephrine-induced increase in MAP was similar to that of WT mice (21 ± 2 mm Hg, n = 16) and was inhibited by pretreatment with either BMY7378 or bunazosin (Fig. 1E). In 1DeC/eC mice, the norepinephrine-induced MAP increase was significantly less than that of WT mice (19 ± 1 mm Hg, n = 12, p < 0.05). BMY7378 pretreatment to 1DeC/eC had no inhibitory effect, whereas bunazosin almost completely inhibited the pressor response (Fig. 1F). In 1BDeC/eC mice, the infusion of norepinephrine at the same rate of 1 e/kg/min did not elicit any increase in BP (n = 14; Fig. 1G).
Vascular Responsiveness of Mutant Mice. We measured contractile forces of isolated aortic segment induced by 1-AR agonists. Norepinephrine and phenylephrine induced concentration-dependent contractile responses in thoracic aortic segments from WT, 1BeC/eC, and 1DeC/eC, mice; however, the potency of norepinephrine was slightly reduced in 1BDeC/eC mice, and the reduction was more pronounced in 1DeC/eC mice (Fig. 2, A and B). The pD2 values for norepinephrine-induced contraction in WT, 1BeC/eC, and 1DeC/eC mice were 3.8 ± 0.5, 5.3 ± 0.5, and 190 ± 40 nM (n = 10eC16), respectively, and corresponding values for phenylephrine were 20 ± 2, 70 ± 10, and 840 ± 40 nM (n = 10eC16) for WT, 1BeC/eC, and 1DeC/eC mice, respectively. In contrast, the contractile response was apparently lost in 1BDeC/eC mice (Fig. 2, A and B). All mice had same levels of response to serotonin stimuli (Fig. 2C; n = 10eC16).
We next examined perfusion pressure of mesenteric arterial beds isolated from WT and mutant mice. The increase in the pressure to phenylephrine stimulation was significantly attenuated in 1DeC/eC and 1BDeC/eC mice compared with WT and 1BDeC/eC mice (Fig. 2D).
Cardiac Functions. The cardiac output of WT and mutant mouse groups were similar level (Table 5). Vascular resistances for the systemic vascular beds were calculated from cardiac output and MAP, and the calculated values were significantly decreased in 1DeC/eC and 1BDeC/eC mice. Vascular resistances were (in mm Hg/l/min) 8845 ± 3191, 7754 ± 2934, 7240 ± 1842, and 6782 ± 1983 for WT, 1BeC, 1DeC,, and 1BDeC, respectively. Myocardial contractility was monitored with either FS or ejection fraction and was significantly lower in 1DeC/eC and 1BDeC/eC mice than in WT and 1DeC/eC mice (Table 5). The left ventricular wall thickness, measured at the interventricular septum and posterior wall by echocardiogram, was comparable in all groups of mice (data not shown). The heart weight/body weight ratio did not significantly differ among the groups of mice (Table 1). In addition, there were no obvious differences among the groups of mice with respect to gross morphology or microscopic myocyte appearance of the hearts and aorta (data not shown).
Nephrectomy and Salt-Induced Hypertension Model. During subtotal nephrectomy and 1% saline loading, six of the 16 WT, six of the 15 1BeC/eC, seven of the 16 1DeC/eC, and six of the 15 1BDeC/eC died with general edema within 6 to 8 days without an appreciable change in BP, and nine to 10 surviving mice in each group were used for analysis. Hence, the Kaplan-Meier analysis at the 35th day showed no significant effect of the 1B gene and 1D gene ablation on cumulative survival (data not shown). Besides, no significant difference was observed with respect to the following parameters: plasma creatinine levels, ratios of residual kidney weight to body weight, blood cell counts, hematocrit and serum electrolytes (data not shown). Plasma creatinine levels and heart weight to body weight ratios significantly (p < 0.05) increased at the endpoint, and angiotensin I and II levels significantly (p < 0.05) decreased in all four groups, compared with those at baseline (Table 1). However, these endpoint data, except those of plasma catecholamines, did not show any significant differences among the groups of mice (Table 1). Although plasma catecholamine levels at baseline were not significantly different, at the end-point plasma norepinephrine, dopamine and total catecholamine levels of the WT and 1BDeC/eC mice were significantly higher than those of 1DeC/eC, and 1BDeC/eC, mice (Table 1).
Figure 3 shows the time course of SBP and HR changes during the 1% saline drinking period, as measured by tail-cuff monitoring. The baseline SBP values of WT and 1BDeC/eC mice were significantly higher than those of 1DeC/eC or 1BDeC/eC mice, whereas there was no significant difference in HR among the groups of mice. After 3 weeks from the beginning of salt loading, the WT and 1BDeC mice showed significantly higher SBP than the 1DeC/eC, and 1BDeC/eC mice (Fig. 3A). The endpoint SBP values were 144 ± 3, 141 ± 4, 124 ± 4, and 120 ± 4 mm Hg for WT (n = 10), 1BeC/eC (n = 9), 1DeC/eC (n = 9), and 1BDeC (n = 9), respectively (Fig. 3A). Eight of 10 surviving WT and seven of nine surviving 1BDeC/eC mice satisfied the HT criteria, as defined under Materials and Methods; however, only two of the nine surviving 1DeC/eC mice and two of the nine surviving 1BDeC mice satisfied the criteria. The endpoint HR by tail-cuff recording were 596 ± 13 bpm for WT mice (n = 10), 567 ± 30 bpm for 1BDeC/eC mice (n = 9), 584 ± 25 bpm for 1DeC/eC mice (n = 9), 583 ± 28 bpm for 1BDeC mice (n = 9), respectively (Fig. 3B). Unlike the SBP response, the HR change did not differ significantly among the groups at any time point during salt loading (Fig. 3B). At the endpoint, MAP and HR were confirmed directly under nonanesthetized conditions (Table 4). Consistent with the tail-cuff SBP measurements, the endpoint direct intraarterial MAP of 1DeC/eC and 1BDeC/eC mice was significantly (p < 0.05) lower than that of WT and 1BDeC/eC mice (Table 4). No significant difference was observed in direct intra-arterial HR among the groups of mice at the endpoint (Table 4).
Vascular Contraction of the HT Model Mice. To assess whether the salt-induced HT procedure caused altered catecholamine sensitivity in the vasculature, we examined the pressure responses to phenylephrine in the perfused arterial beds. As shown in Fig. 3C, the maximal pressure responses to phenylephrine at the endpoint were significantly (p < 0.05) enhanced compared with the baseline ones (Fig. 2D) in all groups of mice; however, the phenylephrine-induced changes in perfused pressure (>10 nmol) were significantly (p < 0.05) lower in 1DeC/eC and 1BDeC/eC mice, compared with WT and 1BeC/eC mice. The response was not significantly different either between 1BeC/eC and WT mice, or between 1DeC/eC and 1BDeC/eC mice (Fig. 3C).
Discussion
We investigated the consequences of simultaneous deletion of 1B- and 1D-AR function in BP regulation. RT-PCR and radioligand binding studies confirmed the deletion of both 1B-AR and 1D-AR gene in 1BDeC/eC double knockout mice and also indicated that the 1BDeC/eC mice had no apparent compensatory up-regulation of 1A-AR. Nonanesthetized 1DeC/eC and 1BDeC/eC mice had significantly lower basal SBP and MAP relative to WT and 1BDeC/eC mice, whereas all mice showed no significant change in HR. The pressor response of perfused mesenteric arterial beds to 1-AR stimulation, however, was not affected in 1BDeC/eC, and significantly reduced in both 1DeC/eC and 1BDeC/eC mice. Furthermore, in the mice lacking 1D-AR, but not 1BDeC/eC mice, development of HT was significantly attenuated compared with WT mice, further extending our previous observation that 1D-AR plays an important role in salt-sensitive BP increase, irrespective of coexpression of 1B-AR (Tanoue et al., 2002b). The present study shows that both 1B-AR and 1D-AR subtypes are involved in 1-AR-mediated pressor and vasoconstrictive responses, but to different extents.
RT-PCR and radioligand binding studies showed that the 1BDeC/eC mice expressed neither 1B-AR nor 1D-AR mRNA in any tissue examined and had no apparent compensatory up-regulation of 1A-AR. Saturation binding studies showed that the reduction of Bmax in 1BDeC/eC mice well corresponds to the summation of reduced Bmax values of 1BDeC/eC and 1DeC/eC mice. Thus, the reductions in Bmax of 1B-AR (in 1BeC/eC mice) and 1D-AR (in 1DeC/eC mice) were 41 and 11% in brain, 55 and 10% in heart, and 2 and 18% in kidney, respectively (Table 2), and those in 1BDeC/eC mice were 51% in brain, 64% in heart, and 15% in kidney, respectively. In addition, competition binding experiment in the brain with KMD-3213 confirmed the reduction of low-affinity sites in 1BeC/eC and 1DeC/eC mice, and no low-affinity site for KMD-3213 was detected in 1BDeC/eC double knockout mice.
One of the possible cardiovascular parameters that contribute to the lower resting BP of 1DeC/eC and 1BDeC/eC is a reduced systemic vascular resistance, as demonstrated in this study. Although the 1DeC/eC and 1BDeC/eC partially retained the ability to increase blood pressure in response to intravenously administered 1-agonists, circulating catecholamines of 1DeC/eC and 1BDeC/eC are similar level with WT and are not high enough to compensate decrease in resting BP. Both angiotensin II and vasopressin evoked similar blood pressure changes in WT and double knockout mice, suggesting that responsiveness to nonadrenergic stimuli was largely preserved in 1BDeC/eC mice. On the other hand, 1A-AR knockout mouse (1AeC/eC), but not 1ABeC/eC double knockout mouse, has been reported to have lower resting BP (O'Connell et al., 2003; Rokosh and Simpson, 2002). Because cardiac functions of 1AeC/eC), are in normal range, 1A-AR is required to maintain resting BP (Rokosh and Simpson, 2002). The BP of 1AeC/eC, mice was not different from that of WT, although cardiac output of the male knockout mouse was significantly decreased (O'Connell et al., 2003). In male 1ABeC/eC mice, the remaining vascular 1-AR, especially 1D-AR subtype, seems to compensate a negative effect of decreased cardiac output to maintain normal resting blood pressure; however, this assumption needs to be verified experimentally.
It is interesting that the maximum MAP of 1AeC/eC upon phenylephrine stimulation was about 10 to 15% lower than that of WT control, suggesting roles of 1B- and 1D-AR in the pressor response to the 1-agonist (Rokosh and Simpson, 2002). In contrast, maximum MAP response of 1BDeC/eC to phenylephrine stimulation was about 10% lower compared with WT. Expression analysis and radioligand binding studies performed on the 1AeC/eC (Rokosh and Simpson, 2002) and 1BDeC/eC knockout mice suggested that deletion of 1-AR resulted in a consistent reduction of total binding sites and up-regulation of remaining 1-AR gene was scarcely apparent. These results indicate that each 1-AR subtype could participate in the vasopressor response to circulating 1-agonist and that redundancy of 1-AR exists compared with the required number of 1-AR to obtaining maximum blood pressure response. Such a finding might have a clinical importance when studies on these knockout mice are translated to a clinical field of antihypertensive therapy.
The question as to which 1-AR subtype is involved in vasoconstricive responses in a particular vascular bed is not easy to clarify, because vascular smooth muscles express more than one 1-AR subtype (Zhong and Minneman, 1999; Guimaraes and Moura, 2001). In addition, the distribution of the 1-AR subtype in blood vessels markedly varies depending on species and vessels (Daniel et al., 1999; Piascik and Perez, 2001). We studied contractile responses in two types of blood vessels: thoracic aorta and mesenteric artery. Our data on aortic contractile response and on perfusion pressure of mesenteric vascular beds are in good agreement with previous reports (Cavalli et al., 1997; Daly et al., 2002; Hedemann and Michel, 2002). Contraction of mouse aorta was shown to be mainly mediated by 1D-AR (Cavalli et al., 1997; Daly et al., 2002) and of mesenteric artery via 1A-AR (Hedemann and Michel, 2002). Hence, our data confirmed the previous observation by Daly et al. (2002) that 1B-AR plays a relatively small role in 1-AR-mediated contraction of mouse aorta. In addition, relatively small contribution of 1D-AR in the contraction of mesenteric arterial beds was observed in a previous study (Hedemann and Michel, 2002). This, however, does not necessarily mean that the role of 1D-AR in blood pressure regulation is small. It was recently reported in the contraction of small femoral resistant arteries that 1A-AR, but not 1D-AR, mainly mediates the contractile responses to exogenous norepinephrine, whereas 1D-AR seems to be activated by neurally released norepinephrine (Zacharia et al., 2004a,b). Because both studies by Hedemann and Michel and ours examined the contractile responses to the exogenously applied catecholamines, the relative contribution of 1D-AR seems to be small. Hence, further studies will be required to clarify the relative contribution of each subtype in the sympathetic regulation of neuronally stimulated and blood-borne catecholamine-stimulated pressor responses, in vivo in particular.
The 1-AR-stimulated pressor responses seen in 1BDeC/eC mice in the present study may further support the idea that the remaining 1-AR, which is mainly regarded to be probably 1A-AR subtype, is a vasopressor expressed in resistance arteries (Rokosh and Simpson, 2002). A number of previous pharmacological and mRNA expression studies have indicated the contribution of 1A-AR to vascular contraction (Leech and Faber, 1996; Piascik and Perez, 2001; Rokosh and Simpson, 2002). Furthermore, Rokosh and Simpson (2002) showed histochemically that Lac-Z, whose gene substituted for the 1A-AR gene in their 1A-knockout mouse, was expressed in peripheral arteries, such as mesenteric artery, but not expressed in the major conducting arteries, such as the thoracic aorta. In addition, the pressor response to a potent 1A-AR-selective agonist A61063 in 1BDeC/eC mice was intact and comparable with WT, indicating that this ligand is selective for 1A-AR-mediated function.
Our next focus in this study was on a direct comparison of 1-AR subtypes in vivo, in terms of their causative roles of salt-sensitive hypertension. Distinct BP patterns of 1BDeC/eC and 1BDeC/eC mice were clear evidence indicating the 1D-AR plays a crucial role in raising BP in this model. Observations in this and previous studies suggest a critical role of 1D-AR on increased sensitivity to vasoconstriction, especially in hypertensive state (Clements et al., 1997; Daly et al., 2002; Tanoue et al., 2002a; Chalothorn et al., 2003). Altered sympathetic activity is another prominent feature of HT. We found that the circulating catecholamine levels of 1BDeC/eC and 1DeC/eC mice under salt loading were less than those of WT. Because plasma catecholamine levels correlate well with spillover from sympathetic nerves in organs (Grassi, 1998; Esler and Kaye, 2000), lower plasma catecholamine levels of 1BDeC/eC and 1DeC/eC mice indicate suppression of sympathetic outflow. In fact, the 1-blocker prazosin has been shown to act on 1-AR in the central nervous system (CNS) and suppress sympathetic outflow (Hoffman, 2001). In mouse CNS, about 10% of 1-AR is 1D-AR subtype, as seen in this study. Although contribution of central 1D-AR to the regulation of sympathetic outflow need to be further examined, our current data clearly indicate that 1D-AR gene knockout leads to decrease in plasma catecholamine levels and in the antihypertensive effects on salt-sensitive hypertension. Using the same hypertension model, the mice lacking one copy of 2B-AR gene had attenuated BP increase compared with the WT group (Makaritsis et al., 1999). It is, therefore, of interest to explore a possibility of functional relationship between 2B-AR and 1D-AR subtypes, because both are found in the CNS and activated by the same agonist (Gavras and Gavras, 2001; Tanoue et al., 2002b).
In conclusion, three 1-AR subtypes differently participate in systemic blood pressure regulation. Ablation of 1D-AR, but not of 1B-AR, reduced resting blood pressure by reducing peripheral resistance. Pressor response to 1-agonist is suppressed according to the number of 1-AR gene deleted; however, an increase in BP of double knockout mice suggests that functional redundancy could exist in 1-AR-mediated pressor response. Furthermore, 1D-AR is an important receptor subtype in the development of secondary HT accompanying acute renal dysfunctions.
C.H. and T.K. contributed equally to this work.
doi:10.1124/mol.104.007500.
References
ALLHAT Collaborative Research Group (2000) Major cardiovascular events in hypertensive patients randomized to doxazosin vs chlorthalidone: the antihypertensive and lipid-lowering treatment to prevent heart attack trial (ALLHAT). J Am Med Assoc 283: 1967eC1975.
Alonso-Llamazares A, Zamanillo D, Casanova E, Ovalle S, Calvo P, and Chinchetru MA (1995) Molecular cloning of alpha 1d-adrenergic receptor and tissue distribution of three alpha 1-adrenergic receptor subtypes in mouse. J Neurochem 65: 2387eC2392.
Cavalli A, Lattion AL, Hummler E, Nenniger M, Pedrazzini T, Aubert JF, Michel MC, Yang M, Lembo G, Vecchione C, et al. (1997) Decreased blood pressure response in mice deficient of the alpha1b-adrenergic receptor. Proc Natl Acad Sci USA 94: 11589eC11594.
Chalothorn D, McCune DF, Edelmann SE, Tobita K, Keller BB, Lasley RD, Perez DM, Tanoue A, Tsujimoto G, Post GR, et al. (2003) Differential cardiovascular regulatory activities of the 1B- and 1D-adrenoceptor subtypes. J Pharmacol Exp Ther 305: 1045eC1053.
Clements ML, Banes AJ, and Faber JE (1997) Effect of mechanical loading on vascular alpha 1D- and alpha 1B-adrenergic receptor expression. Hypertension 29: 1156eC1164.
Daly CJ, Deighan C, McGee A, Mennie D, Ali Z, McBride M, and McGrath JC (2002) A knockout approach indicates a minor vasoconstrictor role for vascular alpha1B-adrenoceptors in mouse. Physiol Genomics 9: 85eC91.
Daniel EE, Brown RD, Wang YF, Low AM, Lu-Chao H, and Kwan CY (1999) -Adrenoceptors in canine mesenteric artery are predominantly 1A subtype: pharmacological and immunochemical evidence. J Pharmacol Exp Ther 291: 671eC679.
Esbenshade TA, Hirasawa A, Tsujimoto G, Tanaka T, Yano J, Minneman KP, and Murphy TJ (1995) Cloning of the human alpha 1d-adrenergic receptor and inducible expression of three human subtypes in SK-N-MC cells. Mol Pharmacol 47: 977eC985.
Esler M and Kaye D (2000) Sympathetic nervous system activation in essential hypertension, cardiac failure and psychosomatic heart disease. J Cardiovasc Pharmacol 35: S1eCS7.
Gavras I and Gavras H (2001) Role of alpha2-adrenergic receptors in hypertension. Am J Hypertens 14: 171SeC177S.
Goetz AS, King HK, Ward SD, True TA, Rimele TJ, and Saussy DL Jr (1995) BMY 7378 is a selective antagonist of the D subtype of alpha 1-adrenoceptors. Eur J Pharmacol 272: R5eCR6.
Grassi G (1998) Role of the sympathetic nervous system in human hypertension. J Hypertens 16: 1979eC1987.
Guimaraes S and Moura D (2001) Vascular adrenoceptors: an update. Pharmacol Rev 53: 319eC356.
Hedemann J and Michel MC (2002) Alpha1A-adrenoceptors mediate contraction of mouse mesenteric artery. Recept Channels 8: 125eC126.
Hieble JP, Bylund DB, Clarke DE, Eikenburg DC, Langer SZ, Lefkowitz RJ, Minneman KP, and Ruffolo RR Jr (1995) International Union of Pharmacology. X. Recommendation for nomenclature of 1-adrenoceptors: consensus update. Pharmacol Rev 47: 267eC270.
Hoffman BB (2001) Cetecholamines, sympathomimetic drugs and adrenergic receptor antagonists, in Goodman & Gilman's The Pharmacological Basis of Therapeutics (Hardman JG, Limbird LE, and Goodman Gilman A eds) pp 215eC268, McGraw-Hill Book Company, New York.
Johns C, Gavras I, Handy DE, Salomao A, and Gavras H (1996) Models of experimental hypertension in mice. Hypertension 28: 1064eC1069.
Kaplan EL and Meier P (1958) Nonparametric estimation from incomplete observations. J Am Stat Assoc 53: 457eC481.
Leech CJ and Faber JE (1996) Different alpha-adrenoceptor subtypes mediate constriction of arterioles and venules. Am J Physiol 270: H710eCH722.
Makaritsis KP, Handy DE, Johns C, Kobilka B, Gavras I, and Gavras H (1999) Role of the alpha2B-adrenergic receptor in the development of salt-induced hypertension. Hypertension 33: 14eC17.
Michelotti GA, Price DT, and Schwinn DA (2000) Alpha 1-adrenergic receptor regulation: basic science and clinical implications. Pharmacol Ther 88: 281eC309.
Munson PJ and Rodbard D (1980) Ligand: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107: 220eC239.
Nasa Y, Yoshida H, Urata M, Uchibayashi K, Tsunoda Y, Kamigata K, and Takeo S (1998) Effects of the antihypertensive agent, cicletanine, on noradrenaline release and vasoconstriction in perfused mesenteric artery of SHR. Br J Pharmacol 123: 427eC434.
O'Connell TD, Ishizaka S, Nakamura A, Swigart PM, Rodrigo MC, Simpson GL, Cotecchia S, Rokosh DG, Grossman W, Foster E, and Simpson PC (2003) The alpha(1A/C)- and alpha(1B)-adrenergic receptors are required for physiological cardiac hypertrophy in the double-knockout mouse. J Clin Investig 111: 1783eC1791.
Piascik MT and Perez DM (2001) 1-Adrenergic receptors: new insights and directions. J Pharmacol Exp Ther 298: 403eC410.
Rokosh DG and Simpson PC (2002) Knockout of the alpha 1A/C-adrenergic receptor subtype: the alpha 1A/C is expressed in resistance arteries and is required to maintain arterial blood pressure. Proc Natl Acad Sci USA 99: 9474eC9479.
Sabath DE, Broome HE, and Prystowsky MB (1990) Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene 91: 185eC191.
Shibata K, Foglar R, Horie K, Obika K, Sakamoto A, Ogawa S, and Tsujimoto G (1995) KMD-3213, a novel, potent, 1a-adrenoceptor-selective antagonist: characterization using recombinant human 1-adrenoceptors and native tissues. Mol Pharmacol 48: 250eC258.
Stanasila L, Perez JB, Vogel H, and Cotecchia S (2003) Oligomerization of the 1a- and 1b-adrenergic receptor subtypes. Potential implications in receptor internalization. J Biol Chem 278: 40239eC40251.
Takeo S, Tanonaka K, Matsumoto M, Miyake K, and Minematsu R (1988) Cardioprotective action of -blocking agents, phentolamine and bunazosin, on hypoxic and reoxygenated myocardium. J Pharmacol Exp Ther 246: 674eC681.
Tanoue A, Endo F, Kitano A, and Matsuda I (1990) A single nucleotide change in the prolidase gene in fibroblasts from two patients with polypeptide positive prolidase deficiency. Expression of the mutant enzyme in NIH 3T3 cells. J Clin Investig 86: 351eC355.
Tanoue A, Koba M, Miyawaki S, Koshimizu TA, Hosoda C, Oshikawa S, and Tsujimoto G (2002a) Role of the alpha1D-adrenegric receptor in the development of salt-induced hypertension. Hypertension 40: 101eC106.
Tanoue A, Nasa Y, Koshimizu T, Shinoura H, Oshikawa S, Kawai T, Sunada S, Takeo S, and Tsujimoto G (2002b) The alpha(1D)-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction. J Clin Investig 109: 765eC775.
Uberti MA, Hall RA, and Minneman KP (2003) Subtype-specific dimerization of 1-adrenoceptors: effects on receptor expression and pharmacological properties. Mol Pharmacol 64: 1379eC1390.
Zacharia J, Hillier C, and MacDonald A (2004a) Alpha1-adrenoceptor subtypes involved in vasoconstrictor responses to exogenous and neurally released noradrenaline in rat femoral resistance arteries. Br J Pharmacol 141: 915eC924.
Zacharia J, Hillier C, and Macdonald A (2004b) Pharmacological characterization of alpha(1)-adrenoceptors in mouse isolated femoral small arteries. Eur J Pharmacol 503: 155eC163.
Zhong H and Minneman KP (1999) Alpha1-adrenoceptor subtypes. Eur J Pharmacol 375: 261eC276., 百拇医药(Chihiro Hosoda, Taka-aki )